Microcebus_murinus Locus Mono:10:SNORA30
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:10:SNORA30
Microcebus_murinus
Mono:10:SNORA30
scaffold_49168
SNORA30
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTAGAGATCAGAAAAAGTTTTCTTATAA
ACTTTTTTTTTTTAGTGAAATGAATATTTCTATCAAAGGGCAGTATTTAATAAAGGTCAG
TTAAATAGAATGTACATTATATGTTCTGGAAAACAATTTGGCAAAATTAAGTTTGTATGT
ATGTACCTTTCCACCCTGAAGGTAAACAACTTAAACTGTAACTTAAACTAACACGTATGT
TCAAGGGGACACATACAAGAATGAACCTAACAGTATTGTTTGCAACAAACGAAAATTTAG
AGGCAGCTTAGATATCCACAGTAGGTGAATAGTCAAATACATTCATGTAACAGAATATTA
TTAAGCAGTGACAGGTAAATGAACTAGAGCCAATTTTTAAACATGGATGAATATCATGAA
TATGATGTGTAAAAAAGCAATCTTTAGAAGAGTTGATATGGTATGATGCCATTTTTTTGA
AGTTTAAAACTATACTAAATATTATATGTTGTCCAGACATGCATCCATATGAAAAAATTA
TAAAGAAAATGTAAGAGGGACATCTTCACCTTCACCAAGCAGTCAAACCTAACTTTACCA
ATAGTGGTACAAGCTGATATTGTTATATGCCTCCTGATATGACAGAGTAAGAAGTTTATA
ACATCACCTCTGTAATATTTCTACCAAAAATGTTTAACTTCCTAGCACTTTCACAGGTCC
TCCCCTATGCAGTGGGGTCAGGATTTGGTAGCTGGTGCTGAGAGAAAACTCTTGATTGCG
TCCTTGCCCTGGCTCTGTACCAGTGGCAACCGTCGCTCAATGGGACAGAGACCATTCTTT
GCCGTCCTACTCAACTTTTTGTGCCTTTCTCCTTTACTCTAACCTTAGGCCCTCCTTCCC
TCTTTTTATCCTTTGCCATACAGAAATTAAAATGTTTAACCTCAGTCTAGGCATGTGGAA
ATAATAAATCCATAATAGAGATTGTCTATAAGATAATAGGCCTTGACTATTCAAAAAAGC
CAATGTTATAAAAATACAAAAATGGGGAGTAATACTAGTTTAAGAGACTAACAACCAGAT
ACAATGTGTGAAACTTGATCATATGTTGGATTCAGCAACAAATAAATATAAAAGACCTTT
CTAAGATAATTAGATACATTTCAATATGAATTGTATATTAGATTATCTCATTGAATTAAT
ACTCATTTTTTTAGGTGTTATAAAGGTACTGTGATTATCTAGGAGGAATTCCATGTTCTT
AGCATAAACCTTCTACATTATCAGATGAAATGCCTTGCTATTTGATATTTTCAAATGGTC
CAGGGAAAAAAGTAACATGTATATATTAATATAAAGCAAACATAGCAAAATTTTAGCAGT
TGGTAAAAGTAGGTGGATATTTGGGTGTTTATTGTATTACTATTTCATTTTTTGGTAGGT
TTTGAAAATTTTCAGAGTAGAAAATGGAGGAAATAGAAGAAATTCATGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved