Microcebus_murinus Locus Mono:13:SNORA18
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:13:SNORA18
Microcebus_murinus
Mono:13:SNORA18
scaffold_84496
SNORA18
1001..1132
1551
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGTTCTTGTATCGAGCTTAGAGCCAGGGCTACCTT
ATGAGGCAGTAAAAAGAACTAAGATGAGGGACCAACCCGTCTGTTTCCAATCCACACCCA
TCACATTCCCAAGGTCAAAGTTATCAAAAGGCATTTTTTACTAACTGTGCCTTTGCCATT
TAATCTGCAGCTCCTCATCATTTTTCTAATAGAATGGTTAATAATTTACCGAGTACGAAA
ATGAAGATTGTGCCTTCGAAGAAACATGCCGCCCCTCCCTCCCTTTTTAACCAGATGATT
GCTAATAACATTAGACTGCTGCCAATCAAGCACACCATTTTAATTTTATGCCCCTGAAGT
GCATTAGGATTCATTTGTTCTCTGTCCCTTTAATGGCCAACATCTCAAATTAATTTTAGA
AACTCAGTAGGTAATGAATGTCGCGCTGCTAAAAAGCTGGTCCTAAACCCAACCTGTGGC
CAAGCAATGGACATCTCTCCACCAAGGAATCTCCGGTAGAGACGTGATAAAAGCAGTTGT
CTTATGAGCCTGGATTTTAAGTAAAAGGGCAAAAAAAATATATATGCCTATCCAGATAGA
TAACATAAAAATATCACTGCATGAATATTAACAGGGGAAATATTGAGGTCTATCTTGGTG
GGGCTTTTTCTGTAGCCATATGTCATTGGAAACGCCTCATAGAGTAACACTGTGGTTTTG
CTTTCCTCACAGGACTATTTGTTAACTCTGTGGGAAGAAACTACCAGACAGTTGCTAAAA
GTATGATACGCCTATTAATTTGTTTTTACCTTAGGTATTGGCAAATCCCACTGACCTGTA
CTATTCTTGAGTGTGATGGCTTTAGGTGCTAATGATTGGAACTCATTCACTTTTCCAAGA
GGGTGTCAAATTGAGAACCGGGCAGATCCATGTCCTCTAAAAATGACCCTGAAGTAACTT
GCTCGAAGAAATTAGATTCCAAAATTTCTTGGTGGGGAGTTTAAGTTTTCGTCATTATGC
CCATATTTAAGTGGAGATAAAAGAAGCCAAAATAAAAAGAATTGTGGCACGCAGCTTCTG
GGCTGACAGGATAACTATGGACTGAGGATCAGTTCTTCTAAAAAGCGCCATCTTGAAGGT
AAATCTTCAAAGACCACCAGCCTTTGAGGAACTAAGGCTACCTTGATATGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved