Microcebus_murinus Locus Mono:125:SNORA73
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:125:SNORA73
Microcebus_murinus
Mono:125:SNORA73
scaffold_17863
SNORA73
1001..1203
2203
TCCATCCAAAAAATAAAACTTTTTGTCTAATATTCATCTCTTCTTGGAACAACCTTATT
TGGATGAAAAATGGAAGAGACTGTGTCTTTCCCTTTGATTTTTCCTCAAAGAAAGGATGC
ACTGAATAAAAAGTCTTCCCCAGCCCAGCGCGGTGACTCACACCTGTAATCCTAGCACTT
TGGGAGGCCCAGGTGGAAGGATTGCTTGAGACCAAGAGTTTGAAACCAGAATAAGCAAGA
TAGCAAAACCATGACTCTACAAAAAAAACAGAACAATTAGCTGAGTGTGGTGGTTTACAC
CTTGTATTCTCAGTTATCCAGGCAGCTGAGGCAGGAGGATCACTTAAGCCTAGGAGTTTG
AGGCTGCAGTGAGCTATGATAACACCACTGCACTCTAGCCCTGGCAACACAGCAAGACCC
TGTCTCATTCATTCATAAATAAATAAATAAATGTCTTCCTCATCTCACCAAAAAAAAAAA
TGTGTATGTAGGAAATATTTGTTGCAGTCATAAAGTTTTTCTAACTTTATTCTTTTAAGA
CACTGCCATTGCCTTTTAGGACACTGCCATTGCCTTTTAGATAACTTAGTAACATAACAA
TGCTTTGATGTGATGCTAAAAATAAAAAAAGCTGGTTCTTCCAGTTTCAGACTGGGGAAG
TTAGTTCTCCAACATCTATTAGGTTGGTGCAAAAGAACTGCAGTTTTACTACTGCTGAAA
TTTGCCTTTTGATATTGGAATACATTCGTACATAAATGTGGTCATGTTATACACCATTTT
AATGTACACTTCTCATGTTATTTTTTTTGCTAATGACTTGTTAGTTGCTAGTTATTTTAC
ATTTCTTTTAGACTATGGAAATGATGTTAGACAAAAAGCAAATTCGAGATATTTTCTTAT
TCGAGCTCAAAATGGGTCGTAAAGCAGCGGAGACAACTTGCAACATCAACCACACATTTG
GCCCAGGAACTGCTAGCGAACGTACAGTGCACAGTGGTGGTTCAAGAAGTTTTGCTGGGA
GGTCACTCTCCCCAGGCTCTGTCCAGGCGGCATAGGGGAGCATAGGGCTCTGCCCCATGA
CGTACAGTCCCTTTCCACAACGTTGGAGATAAAGCTGGGCTTCGTGTCTGCGCCTGCATA
TTCCTACGACTTCCCAGAGTCCTGTGGACAATGACTGGGGAGACAAACCATGCAGGAGAC
AGCTGTCTAGAGCGTGCAATCTTAATCTTGATTTGTCTTCAGTTTCTTTCACTTACTGAC
AAAAAAAAAAGTTTTGCAGGCCGGGGGCGGTGGCTCACGCCTGTAATCCTAGCACTCTGG
GAGGCCCAGGTGAGTGGATTGCTCAAAGTCAGGAGTTCGAAACCAGCCTAAGCAAGAGCA
AGATCCCGTCTCTACTATAAATAGAAAGAAATTAATTGGCTAACTAATATATATAGAAAA
AATTAGCCGGGCATGGTGGCACGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAAGCAGC
AGGATTGCTTGAGCCCAGGAGTTTGAGATTGCTGTGAGCTAGGCTGACACCACGGCACTC
ACTTTATTTTTAGCCTGGGCAACAAAGCAAGACTCTGTCTCAAAAAAAAAAAAAAAAGTT
CTGCAAAGGAGATGAGAGCCTTGAAGATGAGGAGCGCAGAGGCCGGCCATCGGAAGTTGA
CAATGACCAACTGAGAGCAATCATCAAAGCTGATCCTCTTACAACTTACATGAGAAGTTG
CCAAAGAACTCAACATAGACCATTCTATGGTTGTTTGGCACTTGAAGCAAACTAGAAAGG
TGAAAAAGATCCATAAGTGGGTGCCTCATGAGCTGACCAAAAATCAAAAAAATAGTCGTT
TTTGAAGTGTCATCATTCTCTTCTTGTACACAGGGACAATCATTTCTTTATCAGATTGTA
ACATGCGATGAAAAGTGGATGTTGTACGAAAACCAGTGACAACCAGCTCAGTGGCTGGAC
CGAGAGGAAGCTTCAAAGCACTTCCCAAAGGCAAACTTGCATCAAAAAAAGGTCCTGGTC
ACTGTTTGGTGGTCTGCTGCCAGTCTGATCCACAATAGCTTTCTCAATGCCAGAGAAACC
ATTACATCCGAGAAGGATGCTCAGCAAATCGATGAGATGCACCAAAATTGCAACGCCTGC
AGCTGGCATTGGTCACCAGACATTCTTCTCCACAACACCCAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved