Microcebus_murinus Locus Mono:127:SNORA7
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:127:SNORA7
Microcebus_murinus
Mono:127:SNORA7
scaffold_2948
SNORA7
1001..1122
2122
AGAAAATAATAACCTCCCTTCACTGAGAAAATACCACTTTGCTGCAGATCTTAGCTCTA
GGTATTTCAACATCATCTCCCTTGGCTAATATATTTGTTCCTCTCATAGATTGTTATTCT
CGAAGAAAAAGGGGAGGGTAAATTTTTAAGGAGCCACAAATAGACTATTAATTCTCCAGT
ATGGATGACATACCAGAGAATGTTTTAATATGAGAGTATGTTTGAGATATATTTTTAAGA
GTCCAATTAGTATAGCGTCAGAATTCAAAAGAGCTCCACAAGGCAACAAAAAGTTCGCCA
ACGGGGTAGGCTGCTTTCACAGATCAGAGTCATCAGACGCAAAGAAAGGGAATACAAATG
GGCTTATGAGATCACTGGAAAAAATACAAAATTTTTCAGGAGATATTAAGAACTCAGTTC
CTCCAATTCAGGACATAGCAGAGCCTCAGGGCCTCTATGTGAAGTAAATCCCTCCTGTGT
TTGGCATCTGAGTGACTCACCCAGAAAACCATCTACTGCGTGCAGCAGAGAGGAAATGAA
TCATGGAAGCTTCTGACCTTTGCCCTTGTCATCCCTTCTCAGGGAAGCCACCCACAGACA
GTCTCAACAGGGCTGGAGACAGTGCCGTCAAACAAGGCACACTCAGAAGTGATGCAAATC
TACTGGCGGGGAGAGCAAGAGAATGCAGTTCAGGGCTTGCGAGTACAGGATAAACATTGA
TTTTATGATACAGAAAACTTAGCAGTTGAACTGACACGGAGGATGATTTGGCAGTGCCCG
CTGACCTATTGGCTTAAGCAGTAATCTGAACTCCTTACACCACTGGCTGGGGTGGGGGTG
GAAGGGAGTGGCGTGGAAGACAACAATGACCTTTGAATCTCCCCATCTTATATTTGGTAT
TCAGAGAATTTGCTTGGCTTGCTTAGGGGAAGCAGACCAAACTAATGCCAGTATGAAAGT
TGGAATGGATTTGATAGAGTTGTTCACATTTAAGAATATGAGACCTCCTGGGATTATGTC
TGGAGAGTGGCTAGTAGTCTACCAACTTCAAACATGGGAAGGAAAGCAAGCTTGGCAGAG
GTACCCATGGTAGCTGGCGATTAGAAGACACTCTGCAATTCAAGTCCTCGGCAGGAAAGT
CTCCTTCCAGGATTCTTCTTCAACTGGGTCTGTTTATGTCTTACAGAAAAAAAAGAAAAG
AAAAGAAAAGAAAAGAGAAAAATCAAAACCCAATGCCTGCATTCTGAAAAGGCAGTGAGT
TTACAATCACTGGTCCCAAAATATTAACACAATCTGAATAATTGTCTACAGCTATAGTCT
GATACTTTAGGTTGCGATTTCAGTTTTAAAATCAGAATGCCTTCAAAATGCTAATCTGAA
AGCTAAATATGATTCATCCAAAAACATGTGCCGAGTAGAAAGCAAACACCTGGAGACAAG
AAGGAAAATCTCTAATTACCTGCATTACTGAACACAAGTGCATCCAGGGACTGTCTGCCG
AGGTGAGGTTGCTCCCAGTTTCTCTGATCACCTGTCAGGGCGAGGGAATAGGTGACTAAC
CTGCTGAGTCGCAGAGTTCAAAGGCATTTCCTTTCATCCAAGGGTGAGTTTTTAGTGCAA
GTTCTCTCCTCATGCCAGTCTACAAATAGCAGTATAGCTTCCTAAATACCTTATCATAGA
AGAATATACCATTTCAAAAACATCACCCAGGCCTTTGCTCTTGGGGTGAACTTGGCTAGG
AAACTTTGTCCTCGCTGGCTGGGAGAGTGGGAATTAGGCATTCTGCCATACAGCTAATTC
AGAGCTCTCTTCTGTGCTTGGTAACTCAGGCCCACAAAGGACACTGGATGTGGGATGACG
CTCTCATTGTAGCTCAAGAAGGAAGATTGGGGCTGACCTTAGAACCCTTTCTTTCTACTC
CCACTTCCCACTCTGGCCACTTGGATGTTCTCTCTTCTTATCCACTCCAAATCATTCTAC
TTTATTAAATCAGAGAAAGGAGATTAGTCATTTCCAGGTAGATAGGCAGCCTGCGTTGGT
CCACACCCTATTATTGCCCTCAGCATTTACCAATGGGAATCCGAGTGATTCAGTCTTCTC
TCATAGCACAGAATGACAGTATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved