Microcebus_murinus Locus Poly:15:SNORA32
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:15:SNORA32
Microcebus_murinus
Poly:15:SNORA32
GeneScaffold_3819
SNORA32, SNORA25
1001..1122, 1432..1559
2559
GTTTCAATCGTACCAGGTTCCCTGTCCTCACCCAAACATACCATGCTGTTTTAGACCCT
CGCACCAGCTATTGTTTCTGCCTGGCATGCACTTCCCTCCACAGCTGATGCAGTATAGGA
TGATAACAATATTAATAACAATAGTAGTAGCAACTGCAAGCACTTATATGGAGCTTACTA
TGTTCCACGCATGTTGCCTAATAAACCCATTTAATCTTCACAGCAACTTTAAAAGATAGG
TACTACCATTAGCCCATTTTAAAGACGAGAAAACTCAGGGATGGCAGATTAAGTCACTTA
ACCAAGGTTCAAAGTGGCGGAGTCAGAATTTCAACTCAGTTTGATTTGACCCCAGAACCC
GGCTCGTTCCCAAATACAGTGGTTATAAGCGCAGGTCTGGGATCAGATGGTCAGAGTTAG
AATCTTGGCTCTGCAATGTATTAGCGGTGTAGCCTTGAGGAAGTTGCTTACATTTCCTAA
ACCTCAGCTTACTCATCTGTAAATGGAAATAATAATGGCTATATATTTATCAGTGTTTTG
TGAGAATTAAATTAGATATTTCATGGAAAGTGCTAAGCACAGCGCTTGGCATGTAGAAAA
CCTTCAGTGATTAGTAGCTGGTGTCATTATCCGCACATTAACATAAACAGTGCATCAACA
TACATGGTAATTGTGGTTGAATTGATGCTTTGGCCTCCCAGATACTATTTGTAAGGTGTC
CCTCACCACACCTGGCCTGAAACATAGGCTTTTTTCTTCCTCTAAAAAACGGGAAATCCC
AGAAAGAGAGTCAAAAAGGGCTTTCAGGGATCACTTGGCTCAGGCTCCTCATTTACAGAA
AAAAGAAACACTTCTGGGAAGGTCAAGGCGCTTGCTCAACTTCACACTCCACAGACAGCA
GCGGAGCCAGGCCTGACATCAGGTTGTTCCCTGGTTCTGGGTCTAGCCTCTTCCCAATCC
ACCTGCTATCAGGAACTCTGTCAAGGATATTATGACTATAATGGTCATTACCAAGGCTTT
TAGAATGCAGTTTCTCATTTGCTGTGGACATGACCATAAAAAAACTTCCCACTTAGGTTT
TCTATCTGCTACTTTGCTAGCACTCAGCCTAGTGGGAACATTTTATTAACCCTTTATTAG
ACTGTTTTACTTCCATTGCCTAGATGAGCACTGTCCATGTGAAAATACAAGGCAAGCAGC
ATGTGGTTATTTAATATCTATGAAATTTATAGCGAACTCATTTCACATTCTCACTGGCCA
CAGTGCACACCTAGCTAATTATCATTATAACTCTTCTGGATTGCTAATAAGTAGGGTTTC
ATTATGTGATCATCTCTGGAAATGTAACTTTTATGTTATGTAGGGCTGACAGGACAACTA
TGGATTAAGGATCTGTTCTTTTAAAAAGGTATGTACACATTAGGAAAGACATTGGTCATT
TCAAAGAGGGCTCATGGAGTTGTGAAACCAAGAGCTCTTAACGCTGTGACCAAATATTGA
AGTTCTCTGCAGGATGCTGTAACACTAAATAGTGCTATGTTTTCCTGAGGAGAGGTACAA
GACATTGCCAAAAAAAAAAAAAAAGAATATTATGAGTAATAAGACATAATCAAATAATCA
AAGTTCAGAGAAGCTTGGCTCTTAACATAACCATCACGACTGTATTGGGTCATTGACTCT
CCATTAATTCAACACACTGTGAGTGATTTGGAAGGGGCGAGTACAAAGCGTCCATGCGTG
ATACAGTGCAACAGAGGAGGAAGCGGGTCATGTTGGGGGAATCATTTGTTGTGGGAGTCA
TTTAAGTTGCAGATTGTCACAATTAAACACAGCCCTAGCCCACGTTTCACTCACGGTTAC
TAGTGAAAAGGACCAAGTCCTGTGACTTGGGCAAGCCCTTGAGGCTCTGAAAAGATCATG
GGACGAATGCTCTTTCCTGGCCCCTTCTACCACTGTAGAACTCAAAAGCAACTTATAAAA
CGTAAACCCAACCTAGTTCAGATGTCCTCCAAGATTATTATTACCACATTTTTTAAAATA
GCAAATAAAACGAAAGTTTGGAGTTTCTTCTTTTTTGAGCCCCCTGCTGAGCAGGAGCCC
AAATCCAGTGCTAATATTAGTTCACTAACTATGAAACGTCCGATTTTGAATCAAAATGTA
GCTTATCATACCTCAAACGAGAAGGGGTACAATTAATTAAAGTATGTGCCTAAACTATCC
ACACAGTTTTGCCATCTTAATGATAGCTGGTTTATGCCAGCAGCGAAGAAGCCTGGAGAG
CGAGAGGCGATGAAATTGCGAAAGGCATTTTCCACAGCTTGTTGAGAATTCAATATTTTT
CCTTGCAAGATGTGGTCCAAAGTCTGGAAGAAGTGGTAGTCAGTTGGTGCAAGGTCTGGT
GAATACAGTGGGTGACAGAGAGTTTCCAAGCCCAGCTGCTGTAGTTTGAGCAGCTTGGTC
TGTGCAACATGTAGTCAAATGTTGCCTCGCAAGAGGACTGGCCTGTCTCTGGTGACCCAT
CTCACCTGCTTAATCACAAGCATCCTCATCATTACATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved