Microcebus_murinus Locus Mono:254:SNORA67
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:254:SNORA67
Microcebus_murinus
Mono:254:SNORA67
GeneScaffold_668
SNORA67
1001..1141
2141
CCTTGAGCAATCCGCCTGCCTCGGCCTCCCAAGAGCTAGGATTACAGGCGTGAGCCACC
ACGCCCAGCCAATCAGGGTGATTTTAACTCCTCCTTCCCCTAAGGAACATCTAGAGACAT
TTCAGGTTGTCACAATTAGGGGGGTGCTACTGGTATCTAGTGGGTAGAGGCCAGGAACAC
TACTGAATATCCTACAATGCACAGGACACCCCCCACAATCAAGAATTATCCAGCCCAAAT
GTCAACGGTGCTGAGGATGAGAAAACCTGCCTTAGAGGAACCCACAAATAGCGCCCGTGG
CTGGGGATGGGAAATGTGGGGGTTGGGTCGAACGAGGCACCAAAGTGCCCCGACTATTAT
AGATAGGATTAAAGAGGACCAACAAAGGATATTATTTCTATCATCTCTCCTGGATTAAAA
TGAAGCAATTCTGTCAAGATGCATGTGGAGCATATCACCCTGGAGAGGTGTCAGCTCACA
CCAACTGTCCTGAGTTCCATGTCATACAGAAAGCCGTCTGACTTACGCCAGATCAGCCTG
GGCAAGAAGGAACCTGGGCACACAATTCATCTAACTGAAATATAAAATACCACAAATGCA
ATTCCAGGACGTAACCAAAAGATAAGCTGGCCTACAGTACCAGAATGAATTCAGTATTAG
TGTCCTTGAATTAACAGTTGTCTCCAGAGGCTAGAGACACAAATAATGACTATCGGTGAC
CATCAAGGCTTTTTGTATACAAGAAGCACTTGTACTATAAGTTCTTACAGCTCCCTTTTT
ACAGATGAAGAAATTGAGGCTCACAGCAAAGTGCTTCTAGAGAAGTCACATAAAGAGGCA
GTGGCAGAGCCAGGATTTAAATTCATACCCTGCGTGTCCCCAGAAAATGGTTTTTTGACC
CATACTGCCTCCTAATTAGACACTATCGCTCTTGGCAGCCTGTGTTTTTGTTTGGAGTTG
GTGCAGGACAGAAATATAAAGAAAAGAAGCAGAAGAAAAACATTAAAACTATCCACACTT
CAAGAGGCCAGCTAGTGCCTTTCTTAGGAAAGCAGCAACTTGGACTAAAATTGGGCATGC
CTAACGTCTTTGGAGGACAGGGGATGCTTACTTCCTCTGCCTTCCCTTGGCTGCCTACAT
GTATACCACAAGTCCCTTCCGGATAGATTTCTCCTCTTATTCATATGCTGAAGTTATTGT
CTTTCTTGACATAGGCCAGAGGCATTGATGTGCAGCAGGTTTTTTCAGTCATCAATTATG
ACCTTCCTACCAACAGGGAAAAACTATACTCAAAGAATCGGTCATGTTGGATGGTTTGGT
CACAAGGGTGTGACTATTAATATGGTGAGAAAAGAAGACAAGATGACTCTGCGAGACACT
GAGACCTTCTACTACACCTCCACTGGGGAGAAGTCCCTCAATGTTGCTGACTTCATCTGA
GAGGGGCTGTCCTGCTACCTAGCCCCAGCCAGGGTTCAGTCTTGAGGGGGATGAGGAACA
GCAGGAGGGGGAGGGAAGGGAGCCAACGGATGGACATCTTGTCATTTTTTTCCTTTGAAT
AAATGTCACTCTTGAGGCAAAGACCATGAAAAAAAAACAAACCAAAAAAACTATCCACAC
TTACCTAAAACAAAAAGATTAATCAGCCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved