Microcebus_murinus Locus Mono:170:SNORA48
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:170:SNORA48
Microcebus_murinus
Mono:170:SNORA48
GeneScaffold_4393
SNORA48
1001..1111
2111
CTGACAAACCCAAGCTCCCACTCCCTGGGGTCAAGGCATGCACACATAAACACCACTAG
CTGGAGAGGAGGACCCAGTCATGTCCACCAGCCCCAACCCTTCCATCTGAAGGGAGACAC
GACCCTCTGAAGGTATCTAAGCCAAAGCTGGGGCTCAAGACGGTTTCCTGATCAAGGCAA
TGGCCGTTTTAGGGGACAAGGAGCCCTGAGTAGACTTTTCTCCTGGCTGGAAGCTGAAAT
GGAATTGTTTTCCAGCCAGAGTATTGACACCTAAACCGCTTTTGCCAGAAGTGAGTATGA
GCCCCAACCTGAGTTTCCGAGAAGAGTGCATTTATTAGATGGAATAGGAATCATGCGCTG
TGGTGTGTGCTGGGCAAAGGTGGCAGGGGTAGTGAGACAGCAGCCGGGTGCTGTGCCCCT
AAGGCCCGGCTCAGGCTGTGGTCAGGCAGGTGTTCATGTGGCTTCAGTTTCCACTGTGGA
CAAGATCAGGACTGTGTGTGAATTGAGGGAAGATGAGGAAGACATGCAAAGAACACAAAC
CAGCCCCTCCTTGGCTGGGACAAGGCATGGAAGAAGAAGAGGTGGGTGTGGAAAAAAAGG
CAAAGTGACAGGCCAAGGGAGCAGGAGTCCCCAGAACAGATCCTGGCTTTGATGGCCGGC
TCCCTGCTCACGGTCAAGTCAAACCTAGTCAAGGGAGGTCCCAGCATCAGGGAACAGAAT
TAGGGGAAAATGCACCAGTTTTTGTTAACAAGTCGGGGCTGGACCACCAGGACTCTGAGG
TTCCTTCTTGTCTGGAGAACTGAGGCTTGAGAATTCTTTACTGTTTCTTTCCTACAGACA
AGAAGTGTAAGTCTGGACCCTGCCATCTGGATAATTCAGGTAAGGGCTGCAAACAGCTGT
GGGACTCAGCTAGGGGATGAACAGGTTGTCCTGGGGTTGGGCCCTCACCTGGATTTCCCT
CCTATAAGAAAAACCTCCTTAATCAAACAAAGTCAACTCTCTGTCCCTGACCTGGGTAAA
GTGACATCTGGTTGGTGATGCCCATCTCATATCAGCCAGGGACAAGGCACCCCCTTGTTT
ATCCCAGCTTGGTTCATGCCTTGGACACATGGATTGCTGTGGGACATGGGGGAACTCTCT
TAATCAGGCACCTATAGGGGTTGCTAACCTTGCCCTGAGATGTATACGTGGTAGGGGTGC
TGGTTAGGGGAGCAGAGACAGCTACTCTCCAGCCTGAGTCTGCCCCGCCCTTACAGGAGA
AGACCACTGATCAGGAGTCAGGCTGCTCCCCACAAGGTCCTCCCTTCAACCCTCCTCCTT
CAGTGACAGAGCCCACTGTCTCCGTTGCTGCCCTCAGGACTCCCTTGGACCCACCTTTGA
AGGCTGAGGCCAGGCCTTGGGTGCTGGAGGCCTGGGCTCTAGTACAAGCTCTGCACTAAC
CTCTAACCAACTCATCTTTCTCTGGGCCTCAGTTTCCCTATATGTATCATAAGAAAATCA
GACCAGATGATCCCCAGGTCCCTCTCATCTGTGACTTTTCTTTTCCCTTAAGTACCTATT
CTGCCAAGGCCTACCTGGGCCACCACTTCTCACAGTGGGAATAAGCTTCCAGGGAAGAAA
CAGCAGCTCCTCGCCAAGCCTTGGTCTCTCCTCTCTCCTCAGGCCTCTGGGGATGGTGGG
CAGGAAGGGTCCTGGCCTAGGCTTTGTTCCCGCCATTCTCCCTGGCATAGTAACACTCAG
TGTTCTGTGCACACCATCCCACTAATCCTCACCACACTCCAGTGGCGGAGATACCATCAT
CACCCTGGTCTACAGATGACAGAACTAAGGCACAAAGAGGAGAAGCAAGCAGCCCTGTGC
TATGCAGCTGGTAAGGGGTGGAGTCCAGACAGCCTGGCTCTACAGCCACACTCTGAAGCA
CACAGCAGGATGGCGCCCAGCACTCCCCAGACAGCATCTCATGCATCTTTCCATATAGTC
ATGTGTAGTATCTATATCTCGCTAAATAGTAAAGTGAGACCCTGAGACAGAAGTGACTTG
CCCAAGGTGACAAAGTGAGTTAGTGGCAGAGCCAGGACCAGAAGCCAGGTCTCTAACCAT
CTTCTTTGAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved