Microcebus_murinus Locus Mono:102:SNORA67
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:102:SNORA67
Microcebus_murinus
Mono:102:SNORA67
scaffold_5346
SNORA67
1001..1140
2140
TTGCTTTTGGCAATTCATAAACCCGATTAGCTTTGTAAGACAGACTTCAATTAGAGAAG
AGAGGCTTCTCTTTTATAGGTGAGACAATCCCCACACATTGTGTGAAGCTGCCCGAAATC
AAGCTGCTCTGATCTAGTGTGAAGGTCAATGTAATTCCTGTAACACTTAACTGTGACCTT
GAGTAAGATACAAGCTCTTTGAGAATCTGGTTTTCTTATCTGTTAAATGGGCATGATAAG
ACTTCCATGACAGAATAATTTGTGGCTAAAATAGCAAAATACAGAACAGTACTTGCTACA
ATGTTTGTGTTTAATATAGTAAGTAAATACAGTAAATAAGTGTAGCTTCTGTTAATCAAC
TTGTTGCTTTTTTGACGCAACACTAAAAAGCTTCATATATTTTGTAGCAAATGTACTGAT
TTTATTAGAACTGATGAGTTCTTTAAGGTCATTTATAAAAATCTTAAGTGCATCTATAAG
CTGTGAGGGCAATGAGACATTAAAAAAGAGAGGGAAGAAGGCAATTTGCCCTCTCCACCT
TACTAACATTGATAAAATTGATCGTTCACTAATCAATAGCATTTCTGACAGCCTTTAGGG
CACTTCAACACCTGATCTACCTCCTAACTAACTTGTCAGCTGCTACTACATGACCTCCAT
TTATCTGCTGCAAATCGAGACCATTATAAGATGATTCACTAACTTTCATCCTGGCCCTCA
GCTAGATATTGTTATCTTTATTATATTGTTGACAATATAATAATACTATTAACACGTTAA
TAATATTAATTTAAACTTTTCCTTCATAATTATTACTTGCACATTAAAATTACATTTTTT
GTTTTGAAAACCACATTTTACTTCAAGAAACGGTATGGTCTACCACGTGATAATAGATAG
CATCAATCATTTCAGAGTTAACAAAATGTGTAATTAAAGAAAAGTTTACCACAGATCTTG
AAATGATTTTAAATTTAATATTACCTTATAAATTACAATAAATCCAAGGTGATTCCCTCT
TTGAGGCCAACTAGTGCCCCTCTCAGGAAAGTAGCAAATTAGAATTAAATATAGCATGAC
TAAGGTCTTTGAGGGACAGGGGTTGCTTACTTATTTTGCCTTTCTTTGTTTGCCTGCATG
TATACTTAAGTTTCTTCTCGATAGATTGTGTCCTCTTATTTAAATACTGAAGTTGTAATA
AAAAAAAGATATAAATTATAATATCTACTACATACATTTGAAAATTGTCCAATAAAAGGC
CATGATGCTATACAACACACACTCAAACACAAACATTTGTATATATAAAGGCTATTTGTT
GAGACCATGGTTTAAAAAGATCTTTTGCAACTAAGAGAGCTGTTTCCCTCTGGGTCCTCT
CTTGACACTTTGGGTATCTGCATTAAATCTACAAGAATCTCAGAGAATCTAAAATAATGG
TTCTCATTCATTATTCTCTGGAAGCAGTTTGGAAATCTGTGACAATATTTTGGATTGCCA
TCATAATCGGGTGGTACTATGCCACGTAGGTGGGTGAGAGTTTGAGAGGTCAGATGCCCC
GTAAGTTAGTAGACAGTTTCATACTACATTTAAATTTTCTACCAGGAATTCCTATATATG
AAGAACCGGCTTAAATTTATTTTAGTCTAGAAACCAAACTCATTTAACTTATAAATTCAA
AGTATTTTGGGGCAGGTTTTTAATATACACTGAATTTTTCTAGAAATTTATCACCATGTA
AATAAACAAAAGATTGTTCTTTTGTTTTATTTTAAATTGAACCAAGAATTCACCAACACT
TTTACAAAGGGGGTGATTCATCATTTGAATATCAGGTGACTAAAGTGCAAGGTTGTACGT
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGCGCCTACAAATCAA
TAAAAGGGCCAACAAATCAGTAACAAAAACTGGGCACAATAAATAAACAGGGCTTTTCAA
GAAAGGAAACACAATGGCTCTTGCAACATATGAAAAGATGCTCAACCTCACATTTCAACA
CAACAGATCACTCAAGACTTGAAAGTCTGAGGAAATATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved