Microcebus_murinus Locus Mono:106:SNORA8
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:106:SNORA8
Microcebus_murinus
Mono:106:SNORA8
scaffold_24134
SNORA8
1001..1138
2138
AGCTAGGACTACAAGTGGGCACCACCATGCCCACTTAGTTTTTATTTTATTTATTTATT
TATTTGCACAGACAGGGTCTCACTCTGTTGCCCATGCTAGTCTTGAACTCAAGTGATGCT
CCTACCTCGGCCTCCCAAGTCTCGGGGTTCACAGGGCTAAGATTACAGGGTGTGAACCAC
AATGCCCTTCTACATTCTTTAATTATGTACCTGGGTTTAAAGAAAGCAAGAGAATCCCCA
AGACAAAACCAAAAAGAAACTGAAAACCAGAAGATTCCTCTGCTCTGATTATTATTTGCC
AATTGCAGTAACCAAGGAGTTGAAATTTTAATGGTCCCTCAGGGAGAAGAGACAAGGCGT
TCGGCCTGTACAAGACAAAGAGTTGGAATGATAACCAGACATAAAACCAAGACTCTCAAA
GAGAAATTCTTTCAGTGAAAGACAGTGTTAAAAAAGAATACTAGGCCAGGCGAGGTGGCT
CTCACCTATAATCCTAGCACTCTGGGAGGCCGAGGCAGGAGGATCGTTCAAGGCCAGGAG
TTCGAAACCAGCCTGAGCAAGAGCCAGACCTTGTCTCTACTAAAAATAGAAAGAAATTAA
TTGGCAAACTAAAAATACATAGAAAAATTAGCCAGGCATGGTGGCACATGCCTGTAGTCC
CAGCTACTCGGGAGGCTGAGGCAGGAGGATCGCTTGAGCCCAGGAGTTTGAGGTTGCTGT
GAGCTAGGCTAATGCCACGGCACTCTAGCTGGGGCAACAAGAGTGAGACTCTGTCTCCAA
AAAAAAAAGAAAAAAAAAAAAGAAAAAGAAAGAAAGAAAAGAATCCTCTCTCCAGGAAAA
ATAAAAAAGATGACATGAACTTACTTGCCCTGGCCTGGCCCCTGAATGGAAGATGAAACA
TCTTACCTGAGAATTTATAGGCAAAGGCCCACTCTCATACAGTACAGGAGTTCAAATGTA
CCGTGCATGATTTTGTCTCCTTGAGTTCAGAAGCTATCATATGCACTGCACAGTTCTGCA
TTTAGCAGTTAATTCCTGCTAAGGCATGCAAAGGTCAGTGCCACAGAAATTCAGTATCTG
GCATCTTTGGTTTTCTCGGCTTTGTGCATATTTAACCTTGTATTTGTATTGATAGAGTAC
TTCTATAGTTTTCTTACATTACTCAGTTTGATATAGTCTTCAATAGTAACTAAGGCTGCT
TTTTAAAATAAAGATGAAAAAAGAAATTATCATAAAAAGTGATTTTGGATTAAAAACAAC
CCTGGAATTCCTAGCAAAAGCCAACACAGATCTGCTCCAGAGAGACACATACTTAGTGTA
GGCTTCACAAGATTCTGACACATAAAACCTTGCCTAATAAAAGCCCCAATACAAAATTAG
AAAACAAATTAAAAAGCAAAAACAAATGAAAATCAAGCCACCATTAGCAAGAGTTTTCAG
AAAAAATATGTATCAGAATGAGAACCTCAAAACTTCTGAAAATGGGATTATTAGATATAA
GCAAAATATTAAGTATATTTAAAATTATTAATTAATTAAAAGGATGACAGACATGAGATA
GGAACAAGGTACTGTCAAAAATAATAAGGCAGATTTGGAAAATACATATATAGTACATCT
AGATGTCAATGAAATTTAAAAATCAATAAAGGACTTCCACTCTCAATAATGGCACTGTGG
ATCATCACTCTGTGAACTAAAAATAAAATCCCAAGTCTTCTGCTAACTGAATAGGTCCCT
CTTGACCAAGGGGACCCCAGAAACACCTTAAAACTGAGTTCCCAGCCATGACAGGATGGG
CGAGATAAAGCACAATTATAAATGCACATGATTTCTCTTTTCATAAATATTCATGACTCC
CCCTATAGTTTGTTGAATATATATATTTGACCACAGCACTCAGTATAAAATCCCATTCCT
TTTGTATCTTCCTTGAAAGCACATACGTGTTCCTGACTTCTGGCCAGGGCTCTGCTTTTC
AGCATGTTAGAATGGCTGCCTAACGGGCTGTTACCCTTATGAGAAATAGAATTCTTTTTC
CAAAGTACAAAGTGCTTTTTTTTTTTTTTTTTTAGTTAACAAATCTTACCTAGATTAAAA
TAATTATTTTCTGGAATTTAACAATTAAAAACTGTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved