Microcebus_murinus Locus Mono:300:SNORD88
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:300:SNORD88
Microcebus_murinus
Mono:300:SNORD88
GeneScaffold_2209
SNORD88
1001..1091
2091
TTTTTCTCCAGTTTTCAGAGTCATCTTAAGTTTGTTTTGTATATAACATCCAAGGTATT
TAGTATACTTATAAGAGGAATAGGAAAAATACAGGTACTTCATATTTTCTTATATCATGT
TTTTTGGACTGGAAAATCATTGAAAGTGAAAGTTGAGGAGATTTTATCATTAGTATGAAC
TCCCTTAGTTTTACATATGAAGAAATGGGCTAGAGTGACTGAAGGTTTATCTCAGTTACA
CAGCTGGTTATTGCTGGGGCTATAACTAGAAGCCAGGTGACTTTGTCTATGTCTAGCCAT
AATTCTATTATCTTTAAATCATACCCTGAGAGGTCCCTTCACTGCCAGACATATTTGTGA
TGTGAACAAAACCTCTGGGCTGACTTTGGCAACTCCTGTGTAGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGAACTGACTTCCTGGTACCAAGCTCTAAGTAATCAA
ACCAAGCAGCAGTCTGTCTATGCTCAGCCTTAGATGTTACCGGGGAGAGTCTTGGGTTGG
AAGAACTTTGGAGGGAAAAAAATGAATTAACTGTGTATTTGTCTAGAACAAGAGAAAAAT
AGCTTCCACATGCCCTGTGTCTCCACCAGTCTTAAGGATCTGGTAGTTGGTGATCACTTT
ACTGGTCATGGATGGCAGAAACAGAAAATTAGAGATATTTGTCTAGCCCTATAGAAAGGT
TAGATAAAGTTTTTATCATTCAATTTGTGTTCTTTTTGCTGTGGTCAGGGTTTTCAATAT
TCTAGTGAAATCTTCCTGGCAAGTATTATGCTAACCACAGCCTAAATCATGGGAAGATGT
GGTAAATGCTGCAGGGATGGATTTCTCAATAACTTTTCCTAGAATTAGCATGCAGTCTTG
TTGACGTGAGCATTTAACATTATTTCTGCATTAATCCAAACAAGCTCCCATGATGTCTAG
CACTGGGGTCCAATCACCCCTGAGGACACAGTGTCCCCCAAGACTTTTGACACCTGGGGA
TCTGAGGGGCCCCGGTTTGATGTAACTTTTCAAAACAACATCACTCCAAACATAATGGCA
ATTGCCAAAACTTTTAAAGATGCAAATATGCTGTCCCCTAAAGTAGGAGTTTCGGAGGGC
CAAAGAAAGATGCAAAGATCAGTTGTTCCTTCTTCATAGACTCAGAGAACCACAGAGTTG
GGAGGGTCGAGGTACACTTTCAACTCCCAAACCTAGTGTGAGGAAGGGCAGGAGCCCTTG
CACTTATTACATGTGCAGTGACTCCACCCACTTATGGCGAGGTGTTAATTTCTTCCCACC
TCTCCTGTCCCTCCCTTAGTCCAGCAGATAACCAGCCTGTGCCCACAGCCCCCAGGGAGG
AAATGGACAGGGAAAAGCCAGAGCCCTTCCATGGTGCTCCCCAAGAGGGAATGGGGAGAG
ATTCAGAATAGCAGTGTCTTGACCTTGACGTTTTATGGAAATCCATAAAGAGTAGATTTC
CATGAAGCTTGTCCAGAAACAGAAGGGGTAGGGCAGGGGCAGGGGACATGAGGAGCAGAG
TCCCATTTCTTCCTTAAATGTGCAAGCAAGAGAAAGGGTGACTAAGGGCTTTTCTGTGCA
CACGGGGCCCCAAGCACCTTGGAAAAGTCCCAAGCATGGCCAGGAATAACAGAGACTCTG
GGCCAGAAGGCACTTGGCAGAACCTGATAGCAGACAGCTCTGTCTTACATGCTGATTCCA
TAGTCCTAGTGCCATTTTAGAAGGAGTGGCCCTAAAAAGAGTGGTTGGATGAGAGGTTAA
CACAGAAATTATTATTTGAGAAAATGCAGTGGTATTTGTTACTTCTCCCCTGAGTTTGTG
GGCCTGTGATTCATACCACTGGGGACTTTGCAGTGCAGTCACATTGATCTTGACAGCATC
TTGTGATGAGGACAGTAAGATTCACAGAAGCTACGTGCTGGCCCTGAGGTCCCACGGCTA
GAGGGCAGAAAAGCAGGAACTGTAGCCAAATCAGACTCCAAACTACACGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved