Microcebus_murinus Locus Mono:303:SNORD62
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:303:SNORD62
Microcebus_murinus
Mono:303:SNORD62
GeneScaffold_2249
SNORD62
1001..1085
2085
GGTATATAGCCAGAGAATGGCCAGAAAAGGGTTGCTATAAAATACAGGGTCCAAGGCCA
GGGAGCATTTGCTTAGTTTAAGAGTGCTACTGCCCATTACAATGGTTAGCAAAAGGTTTT
AATAACATGAGAAACATTTTCAATGTGATTTTATGTGAAAGAGGCTTAGAAGTAAATATG
CAGACTGATCTCAATCATGTGAAGGAAAATTACATACACAAAGAAGTGGAAGGAAAAAAG
CAGAACTCAAAGGAAACATGCCAACATGTTAAATGCAGCTGCCTCTGAGTGCTGAGATTA
GAGTGAGTTTTTAAAGATAATTTAACATTTAATTTTCTTTACTTGCCATATCTCTAATAG
TGAGCATATTTTGTATTGATAATTAGAAAAAAAAATAACTTAAACACTTCCTAAACTATT
GGCTATGAGTGTTAATAAATGCAGCATAGTCCTAGAGTAATTGCTTTTCTTTATCATAGT
TTTAAGGAGGCTTTTTACTCTTCTTTTTGACCTTTAAAATAGCATTTATTGCCTTTTTAT
TGTAAACGTCTTAAAATTAAGGATGTTTTGAAAATGTGTAGAGGAAGGCAGTGTGGGACA
GTGGGAAGAGAGAGCATATCTTGGTTTGGATCTCATCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCTTGCTCTGTCACCCAGTTTAGAGTGCAGTGGTGTCATCATA
GCTTAATGCAACCTCAAACTCCAGGGTTCAAGTGATTCTAAAACCTCAGCCACCATGCCC
AGCTACTTTGTCTATTTTTTGTAGAGATGGGGTTTCCCTCTGGTTCAGGCTGGTCTCAAA
CTCCTGGCCTCCAACAATCCTCCTGCTTCTGCCTTGGCCTCCCAGAGGTCAGGATTACAG
GCGTGAGCCACCCCTCTGGGCCATCAAATTCCTTTTTTTAGTCTCAGTGATGTACTTCCA
GTAGATCCTTCTGACCTCTACTGTGGACTCAATAGCAGGGAGATGAAGAGGACAGTGCCG
GAGAGACTGAGGCAGCCCTCAGTTCAAGTAAAATGTCCCTCCTGAGTGTCTGGGGCAGTT
GGTGCATAGTTAGGTGAGAAAGGTAGGCCAAAGCCTGCTTCCTTCCTCCTGGGCCTGATG
CCACAGCCTCCCTAGTTCCCTGAGGTGTGTCCCATGTGTGTTGTGAGTGGGGCATGTGGT
ACAGAAGCCCGAGGAATTGAGAAGCCCCTGCAAACACACACCTTCACTCTCACTGAGTCC
TCTGGGAAGTGCAGATGTGCAGAAGGGCTCCCTAAAGGGATATTCGAAAATAGACTAAAA
AGAAAAAATCCTGTTTTGGAAAATGGAGATAATAATAACTACATCATAAGATGTTTATGG
GAAGTCATTATAATTGCATATAAAGACGTCTTGGCACATAATGGGCCATCAGTGTTGCTT
TCCTATCTCCATCCTACGACTTGTGAGCTAAGAGTGAGAAGAGATGTTCCCTGCCTCTCA
AGATGTTAAGTTAATGAGAAAAATAACACATAAAACGCATGGTAATCAACTAGAGAGCAA
ACAAAACATAAGTATAACAAGGATAACTAAGATGGGGGTGATTGGTGGCTGAGGGAACCA
TTGGCAACTCATTTTTTCTGGGTCTGGTGAGAGTTTCACCCCAATAGGTGAAGTATATGC
ATGTATGTTAAAATAACTCAAACCAGATTTAAACCCAGAACTCCCCAGAGGCTGTGACTG
GAGTTCTCATGATCTTGGATATATTTGTTAACTGGATAAAAGGCCACTAACAATTATCTC
TTCAAATTAGAGGCTGGGTGGAGGATGTAGCTATTAATTTTACTGTAGAGTGAGTTCGTA
GCTATAGTCTGCTTATTGCAGTAAACAAGGGAAACATGTTTGTGACAAGCAAAAAGCAAA
TCGGCCAGTTTAATGCTAATGTTATTTAAGATATCAGCAAAACTAGGGCATGAGCAAGAG
CAATTTCCTTTTGTTCCAGCCTTTGTCTAAGNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved