Microcebus_murinus Locus Mono:47:SNORA3
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:47:SNORA3
Microcebus_murinus
Mono:47:SNORA3
scaffold_31151
SNORA3
1001..1130
1505
AATAAAAAAATAAAAAGAATAGTTAACTGAAAATAGCTGTATAACAAAACCAATTGTCT
CCTGTGGCCTCTTCAGATTTTCTATAGTAATATCTTTTCAGAAAACACTTAGGATACTTA
TTTTTCCATTCTTTATGGCCAAGAGTGTACATCTAAATTATTTAAGAGGAGTTTCACATT
GAAATTCAAGTTTTAAAAAAGTAAAGGGGGAGGCAAGGGCCCAAGAGCCGGGCACAGTGG
CTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGATGGGAGGATTTCTTGAGGCCAAG
AGTTTGAGACCAGCTTGAGCAACATAATGAGACCCTGTCTCTACAAAAAATAGGTAAGTT
AAATAAGTAAAGAAGAATCGAGGCTAGAGTCACACTTGGTTATTGGCTATTACCTTAGAG
TGCTAGAGTCCTTGGAAAGTAACTGCTGACCTTGTTCACTGGCTATGGCCCTCATGGCAC
AGTCAGTCACCAGGTTAGTGACATGCTTCAGACTGACCTATGTAACGATTAGACTCACTT
ATACCCACAAATTAAGGGATAATATATTTTAACTATTCCTTCAGAAGACCTCTATTACAA
GAATGTATATATTTTCCATAGAGTGTTGTCAATGACTTGAATTTTAGTCTTGGCACTGCC
TCTCCTCAATGATTTATCCTGGTTTCATGAAATAAATAAGGCTAGCCTTTTCCATGGTGG
TTTCTAAAGATTTGTTTAATTTAGCTAATGAATTGAGTGCCTGCTGTGTGCTGGACAGTG
TTCTACATCAGTGAACAGTTTACATTGTAATGAGGGAGATAACAATAAAGATGATAAACA
TAAGCTTCTTAATTGGAGTGACGTTATGAGAGTGGTTAGAAAAATAAAGAAGAGGTAAAA
CACAGCCCTAATTTAAGAGGTTGAAGATTATGTGACTTTTCATACATTGTGTGCCAGCTC
TGATTCACTTAGTAATAATATGAATAATGTGCTCTTTGTATTCACGTTATGATCTTATGG
GCCAGGTGTGGTATCTCACGCACATAATCCCAGCCCTTTGGGAGGCTAAGGCAGGAGGAT
CACTTGAGCTCAGGAATTGGAGACCAAACTGGGCAACATAGCGAGGGTTCACCTCCTCTC
TACAAAAAATAAAAATTAGCTGAATGTAGTGGTGCATGCCTGCAGACCCAGCTACTCGGG
AGGCTGATATGGAGGATCACTTTGAGCCCCAGGTGTTTGAGGTTACAGTGAGCTATGATC
ATACCACTGTACTCAAGCCTGGGCAGCAAAGTGAGCCCCTATATTTAAAAAAATAGAAAG
AAATACGACTTATATAAAGGGGTAAAGAAAATGACCACTACTGTACACACAGTCTAAGAT
ACCTGGCCTGAAAAGGATGAAAAGCAGGAAGGTGCTAAGGGTAATGTAGTTTTCTGATCT
ATCACATAGAGATATATCATTTTCTTCTGATTTATCCTACAAACATGCATTTATAATTTT
TAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved