Microcebus_murinus Locus Mono:71:SNORD31
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:71:SNORD31
Microcebus_murinus
Mono:71:SNORD31
scaffold_41525
SNORD31
1001..1071
2071
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAGTGAGTGGTGA
TTTTTTACCCAAAGTTAGGGCTATGTAAAAGAAAAACGAAGCTGACCAGGAATGAATTGT
GTACTGTCCCAGTCTGTGATCGCTGTAACTGAAAGGTATTTTCTGAACTGTGAAGAAAAA
AAAACAGAAAAAAAAACAAAAAAACAGAAGTCTGAGAGGCCATATGGGAAATCAGCTTCT
AGGAATAATAAAAGTTATTTATCTGGAAAAGAGGGTCTTGCTCTGTCAGGCTGGAGTGCA
AGTGGTGTCATCACAGCTCATTGCATGCAGCCTCAAACTCCTGGGCTCAAGAGATCCTCC
TGCCTCAGCCTTCCGAGAAGCCGCGACTACTGGTGCACCACCACATCCAGCTAAGGTTTC
TATTTGTTTTGTGGAGACAAGGTCTTGCTATATTGCTCAGGCTGGTCTCAAACTTCTGAC
TTCAATCAATCTTCCCACCTTGGCCTCCTAAACTGCTAGGATTACAGGCATAAGTCACCA
CCCAGCTAAAAGTGAATCATCACTTAACAATATTTATTAAAAGAAAAGCAATTATGTATT
AATATTTAATATATCCACTTTTAGTTTGTGCACTATTAAAACATTTTTTAAAAGTATGCT
TCTGACTTAAATTTAGTCTCCAAAATAATATTAAAATATATTTGTATTTTTTATATTATA
TATTTGTATATTATATGTATATTTGGAAAATCGAAGTGAAGAATTGGGACCGGGACTTGC
TTTGTGACCAGCATATCTGGCTCAGTGACCATGCTCCACCCTACCCCCAGTAAACTTTCC
AAATGGCAAATCTAATTGTATCGTTTTATCAAATAAAATTCTCTGCCTCATTTAGGGAAT
GTTTACTTGATTTTCTTTTTTGGACCATCCTACACATTTTTATGAGAATGAAATTTTTTT
ATTTATGTATTTTATTAATAGTTTGGAAATTATAAAACCTATGTGAAAGTTATTTTAAGA
AAAAAAATCTAGGCCAAGCATGGTGGCCTGCAATCCTAGAACTTTGGGAGGCCGAGGGGG
TTGGATCACTTGAGGCCTTGAGTTCAAGGTTACAGTAATGATCATACCACTTTACTCCAG
CCAGGGCAACAGATTGAGACCCTATCTCTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved