Microcebus_murinus Locus Mono:83:SNORD60
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:83:SNORD60
Microcebus_murinus
Mono:83:SNORD60
scaffold_131682
SNORD60
1001..1073
1162
TAAAATGGGCAAAGAACATAAATAGACATTACTCCAAAGAAGATATGCAAATGGCAATA
TTTGCATCTGAGAAGATGCTCAACATCATTGGCCATTAGAGAAATGCAAATCAGTGTATG
AAAGCCGCATATGCAATCTGATTATTTTGCAAGACTGAGGCTTAGGGGGTGTATTGATAA
TTAATTTTATCAATTGCTGTGCACAGACTTTTTTCTAATTTAAGTTCAATCCGCAGGACA
CACCACCATAAGCCACACCAGTTTTACTTACATTTATTAAGAAGGAAGAGAAAAAGAGAG
AAAGTAAGAGAAAAGTACCACAGGGGAAGAACACAAAAGAGTAATCTTACCACTAGGTTC
CCATTATCAGCACCAGAGGCTTATCATCACGGTAATCTCAACATGGGGGCTAATTCTCAC
GAGCAGTCTCTCAGGCAGCAATGAAGGCAACAAGCTGGGATATCAACATGGAGATGTTAT
ACAGAGAAGCAGCAGCGTAGAAGAGGCTCGGGGACTTTCTTATACTGTTTATATCGTGGT
TTGAACAAAGGAAGGCTTTGGCACCCAAAAGGCATATGCTCTGGTCACGTGAGGTCCCTG
CTTGGGAAGGACATGTCACACTAATGCCCAGAATGTGTTGGCCAGAGCCAGACGCACGGC
CAAGCCTGACATAACTGGGGCAAGGAGGTGTCGTCCTTCCTCTGGGAAGGGAGAGCTGTT
TGTGATCAATAATGTAATCCAGGCCAGGCGCTGTGGCTCACGCCTGTAATCCTAGCTCTT
GGGAGGCCGAGGCGGGCGGATTGCTCAAGGTCAGGGGTTCAAAACCAGCCTGAGCAAGAG
CGAGACCCCGTCTCTTCTATAAACAGAAAAAAAAATAATTGGCCCACTGATATATATATA
TATAAAAAAATAGCCGGGCATAGTGGGGCATGCCTGTAGTCCCAGCTACCTGGGAGGCTG
AGGCAGAAGGATCACTCGAGCCCAGGAGTTTGAGGTTGCTGTGAGCTATGCTGACGCCAC
GGCACTCACTCTAGCCTGGGCAACAAAGCGAGACTCTGTCTCAAAAAAAAAATAAATAAA
TAAAAAATAAAAAAAATAAATAATGTAATCCACCCCAGCGAACAACAGAATTAAAATATA
TAAGCTCAACCCTTAGGATCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved