Microcebus_murinus Locus Mono:165:SNORA42
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:165:SNORA42
Microcebus_murinus
Mono:165:SNORA42
GeneScaffold_956
SNORA42
1001..1135
1793
ATTTTTTTTTTTTGAGACAGAGTCTCGCTCTGTTGCCCAGGCTAGAGTGAGTGCCGTGG
GTCAGTTCGCTCACAGCAACCTCAGACTCCTGGGCTCAAGCGATCCTCCTGCCTCAGCCT
CCCGAGTAGCTGGGCCTACAGGCATGCGCCACCATGCCCGGCTCATTCTTTCTATATATA
TTAGTTGGCCAATTAATTTCTTTCTATTTGTAGTAGAGACGGGGTCTCGCTCTTGCTCAG
GCTGGTTTTGAACTCCTGACCTTGAGCGATCCTCCCGCCTCGGCCTCCCAGAGTGCTGGG
ATGACAGGCGTGAGCCACCGCGCCCGGCCTAAAACTATTTTATTAGAGACGAAAACTTAT
ATTTATTTATCTTTGTGTAGAGGTGGGGTCTTGCTCTGTGGCCCAGGCTGGAGTGCAGTG
GTGTGATGGTAGCTCAAGCGGGACTACAGGCGCACACCACCACGCTCCGCTAATTTTTAA
ATGTTTCTTTTTTTTTTTTTGCAGAGCCGGGATCTCGCTATGTTGCCCAGGCTGGTCTCC
AATTCCTAGGTTCCACTGATCCTCCCGCCTCCGCCTCCTGAAGCAACAGGGTCACGGCGT
TACAGGTGTGAGCGACCATGCCTGGCCCCCCAGTTTTTAAAGTAAAAAGTGGCTGCCGTG
CATGGGTTTGGATTTATGCCAGGCCTGCCCCCCTGGGCCTCTCCTGGTGCCCCATGCCGG
GGGCAAACTGTGGCCCCGAACCGTTGCCTGGCCTGTGCCCGCAGGCTCCCGGCACTGAAT
CGGGTTGCACAGTGGAAAAGAAAAATAAAAAATAAATAAAAAGCAGCTGCCAATGTTAAG
AAGTCAAGGTCCTACACGCCGCTGTAGATTGCTAGTGTCGCCCTCACACTCGCGGCTCTG
GCTGTGGTGGGCCGTTGTTCCCTCCCCCAGCGGGAGCTGGTCCGTCCCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved