Microcebus_murinus Locus Mono:261:SNORA51
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:261:SNORA51
Microcebus_murinus
Mono:261:SNORA51
GeneScaffold_130
SNORA51
1001..1113
2113
ATCCATTCAAAGACCAAGGTAAGAAAAGTCGTGGGGGGTGGGGGGGGGGTGACAAAGTA
TTTCCTTGGTGGTCAGGACATTCCAAAGGGTGCATTGTGTGTGACTGAGACATTTCTTGG
GCACTAAGCTATTGTGAAGTCCTGAGTCCTGATCCACGGTTCTGTGGCTGCCTCAAATGA
CTGAAGGCGGTATCTAGTCTTGAACTAGATCCTAGTCAGGGGTTTATACCGACATGCCAA
TGTTAAGAGTTCCCCATTCTCAAAACATAGGAAGGGTGTTTAATATTCAACAAGGGCAGG
AGGAAGGACCCCTGGAGGTTTTTTGCTTTTTTTTCTTTGAGACAGAGTCTCACTTTGTTG
CCCAGGCTAGAGTGAGTGCCATGGCATCAGCCTAGCTCACAGCAACCTCAATCTCCTGGG
CTCAAGCAATCATCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCGCCACCA
TGCCTGGCTAATTTTTACCATATATATTAGTTGGCCAATTAATTTTCTTTCTATTTATAG
TAGAGACGGGGTCTTGCTCTTGCTCAGGCTGGTTTCGAACTCCTGACCTCGAGCAATCTG
CCCTCCGTGGCCTCCCAAGGCATGAGCCACCCCGCCGGCCCAGTGGAGTTTTTAACAAGG
TTAAAGAAACAGGTGAGAAAATACTCAGAGGATTGAATATTGATGACCCCTTAGGCCAAG
GGATGTTAAAGGTACATTTTGTGGCCAACACCTGACAAGCTAAGAAGCTGCAAAAAATAG
AGGGTTGGCAGGATAGGAAGTTAGAGGACCTACTCAAAGAGGCACAAAAAGTGTATGTGA
GACAAGAGGAGAAGCAGAAACAGAAGGCAAAGATTATGCTCTCTGCTCTAGAAGAAGCAA
CCTGAGGCAATAAGACCCTTAGAAATCAAAAGACCCAAAGCACCCCATGGAGAGCGTTTC
CAGGGAAGACAAGGAAAAGGGCAACCCAGGGAAAGGGGAGAGGATAAATGTTAGAAGTGT
GGAAAGGTAGAAAAAGGAGGCAGAGTAAAGCTACCCCATGTACACCCCAGCCTAGGCCCT
GTGCCTGGTCTGTATTGTGAATGGGGGAACATGGAGAAAGAATAAAAGAAGAAAGAAAAA
AAGAAGTGTGGAAAGGAAAGACACTTTAAAAGGGAGTGTCTAGACTGCAAGAAAGAGGAA
AAGAGAATACCCTTCATGACTTTTGATTAAGAATTGAGGGGAGGGGGGGTCAGGGACTCT
TATATTGAAAGGTCCTACCAAGAACCCTAGATAAATTTGGAGGTGGAACCACAAGGAGAG
GAAATCACCTTCCTTGTTGACTCAGGAGCTGCCTGCTCCTCTCTAATGTACCATCCCATC
ACTATGCAAGTGTCCAATGAATGTCTGCTTGTATCAGGGGTGAAAGGGGAAAGTTTTAAC
ACCATAATTTTCTAGGAGATTCAGGTCATATACAAAGGCCGGAAAGCACAAGTAAAATTT
CTTTTTGTGCCCAAAGCAGGAAAAAATCTCCTGGGCCGAGACTTGATGTCAAGATTAGGG
ATAGGATTACCTATTAACCAAACAGCAATCCAAGTTTCTTTAAACCTCTGTCCGAATTCT
CCCCAAAGTTTGAACAAAGGAAGAGAATTGAGAAGGGCTAGATGTTTCCCCAGTACAAGT
TAATCTTAAGACTCCAGGGGAGACTGTCAGAATAAGACAATACCCAATTCCTATAGAAGG
AAGGCTAGGACCACAACCTATTATAGAAAGTTTACTGAAGGATGGTCTCCTCGAATCCTG
TATGTCTCCCTTGAACACCCCCATATTACCCGTAAAGAAACTGGATGGATCATATAGATT
AGTTCAGGATTTAAGGGAAGTCAATCAAATTGTTTGGTGTTGGCACCCTGTGGTCCCCAA
TCCATATACCCTTCTCAGCAAGATCTCTTATAGCCATAAATGGTTTAGCGTAATGGATCT
AAAAGATGCCTTCAGGGCCTGCCCTCTGGCTGAGAATAGCAGAGACTTGTTCTCTTTTGA
ATGGGAAGATCCACACACTGGGTGAAAACAGCAATACCAGTGGACTGTCTTTCCCCAAGG
TTTTGCTGAATCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved