Microcebus_murinus Locus Mono:244:SNORA48
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:244:SNORA48
Microcebus_murinus
Mono:244:SNORA48
GeneScaffold_3821
SNORA48
1001..1135
2135
GGAAATCAGGCAGGTGGGAGGAGGGGGTAGGGTACAATAATGCCCACTATCTGGGTGAT
GGGCACACACTTATAACTTTGACTCAAGCAATATAAAAGCGATCCATGTAAACTGTTTGT
TTATAAATGTTTTATTTGTACCCCTGTAATATTCTAAAATTTAAAAAAGATAACTCAATT
TTCTTTGCTTCCTAAACAAGAGAGTGTCATCAGATAAAGTAAAAACAGTGACAATCAGGG
AAACAAAGAATATGAAATGCTAGATCTAGAAGGACCCTAGAGATCAGCCAACCCTACTGT
TCATACAGATGGGGACGCTGAAGGCCAAAAGACGCTGAGTCACTGTCCAAGGTCACACAG
CTGGTCAGCAGCAGCCTTCGCCCCAGGGCCCATATTACCTCCCACGTAATTGACTTGCAT
TTACAATTCAATTTCAAAACCAAAGTTCAGGCTCTTTAAAGGATTTGCAGCCCATTTTTC
CTTTTTCCCAGGAGTTGAGAGCTTGTGACCTGTCACAGCTGCTGTGCAAGGGAGAACAGT
GCAGAAAATGCATTCTTAGTCTAAGAGAGGAGAAGGTGCTGAGAATCGCCAAACCTCAAG
TCATAAAAGTCATCCTTCCATTCCAGTAGTTTAGAAACATTCTAGAGTGTCTGGAATAGC
AAAAACTGAGGTGCTAGGGGCAGGGCCTTCTCAAGAGGAGGACCCAGGTCCCTGGAATCG
TGTTCTCCTTTAACAGCCCCACACCCCAGTTAGCAGATGCTTCTCCTGAAGTCCATGTGT
ATTTAAAACTTTTAAAATATTTGCTAAAATTTATTCTCTTGTATTTATAACATATTGAGA
GGCCAAGGGACAACTCAAAATGTTTTTATGAAATGCAAAATAAGATCATTGTGAACACAG
ATATACTTCGTGACAATCTTGAGACAAGACACCTCACACTCCCTACCTACATCTCCTCTG
TATACATCTTTAAATCAGAAGAGTGTGACAAGTCCGAATGATGTCCCAGCCCTGGGCAGA
GTGGCATCTGGTTGGTGGTGCCCATCTCACATCATCCAGGAACAAAGCAACCCCTTGTTT
ATCCCAGCTAGGCTTTTGGTCTGTGCCTATGCCTGGTTCATGCCTTGGTCACATGAAAAA
AAGTCTGAATGAATCCAGTTTATACCCTGCCCATGGTGCTAGTGAAACAAGCAGGGATTA
TAAACAGGAACCCTTTGGTAGAGACTAATCCTTCAGGGGATCCCATCGCAGGCAACAGAA
AGCAGGGTCAAACCCTTAAAAATAAGTCAGAGAAAAAGCAACCTTAGTGATTATCTGGTA
CAAACATAACAAATAAATGCAAATGATATACCAGCTAGCAGTTGTTGCCTGGGACATAGC
AAAAAGATTCTGAGGCCACACCAAGTTTAGTAGGCAAGACTACCTGGGTTGATTAACCAC
ATCAACCAGGGGCCCTGGGTTAGGGCAGTGGGGTGGGTGAAAAAGATGAGGGACGGAAGG
GAAGAGATTCCTGGTGGAAATGTCCACAGGCTTCTGAAAATGATGACTTGTAGGAATCAC
ACATTTGGAAGACATCTGAATGACAACGATGCCATAAGAACGTGAAGCTGCCAAGAAGAG
AAAAGAATAAAAACAAAACCTTGGAAAATTCATATTTGGAAAGGAGGAAAAGTAGTTTTA
AGAAAAAAAAACTGACAAAAAAAGAAAATTCAGTATCACAGATGTCAAATAAAGAAGATA
TTTTTAAATGTTCAATGGTTAAATGCCCCAGAAAAACCAAAAGGCATGAGGGCAGAGAAA
AAGAACATCTCATTTGGTGGCCAGAAAGCAACTTCAGTAGAGTGGGACCAAGGAATCGAT
GCTGCTGGAGAAGTGGAGGGAGACGTGAAAGACTATCGTTCTGAAAAATATGGTGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved