Microcebus_murinus Locus Mono:316:SNORA62
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:316:SNORA62
Microcebus_murinus
Mono:316:SNORA62
GeneScaffold_2418
SNORA62
1001..1154
2154
GTGGAATTTGTTGGCATGTAGTTTTTCATAATGTTTACTCATTATTATCCTTTTGATGT
TTGTAGAATCTGTGGTAATAACCCTTCTTTCATTCCTCATATTGGTTATTTGTGTTCTTA
CTGAGACTTTGGAAACCAAATGTCGAAAATGTTGAAGCCATAAGATCAGAAACACCTGCT
TCATACTGTTACACACACAAGAAATAAACATTTGTTATACTAAGTCACTGAGATTTGGGG
GGTTTGGTTGCTATAGCAACCGGCATAACCTTACTTAATGCAGATTGTCATTATTGGTTT
ATATGTTTATGTTCCTCACTATACTGTAGGTTCCTGGAGGCCAGGGGCCATGATAATACT
GATTTTGGCATTGGTTTCAATGCTTAGCACAATACTTGGTGAATATTAGATTTTTGACTA
TAAATGGATGAGTGAAATTGTTCCTATGTATTTGTAGTCTAGAAGTTTTCTTTCCCTGGG
ATGAGTGACTCAACTCCAACCAGGGGATTCAACCCCAACCAGATTGCTTTATTTTTTTCT
TCCTCCCTTTCTTTTCCCCACTTTTCTCCTCCCTTCTTCTCACTACTTTCTTTGTTCTGC
CTTTATTCAGAACCACACCTGTGGATTACTCTAAGAGACCTTTTACTAAGGTAAAATTCT
TCAATTCTGATCCTGCTAAAAGGAATTTCGAATAATACAGACATGGGCTGGGCTTAAATT
TGCTTTTGCTTTCTTACCCAAACATATAAACAAAATCAACCAAATGAAGCACAACGACTT
TCAGAACTCTATGCAAATGACTATGTAAAAATGGATCCCAGGGAGGAACATTGAGATTAC
TTGGAAGAACAAACTTTTAAAGGATTTTTCTGGTGGTGTCAGTTTAATCCCTTTGCATAT
ACATAATTACAAATTATATTTACTTAAAGTAGGTATCAGGTTCATATTTTGCTATACTTT
AGCACATATTCCTATAAAATAATTTAATCAAAAATATTTTCTGTGTACATTGTTAGAGCT
TGGAGTTGAGGTCACTGACTGGCTGATGAGCTCACAAGGGTAGATAGTGTGCTACATGAG
CCTCAATGTTTTTGCTAACACCATAAGGGTTTCTGGCGCAATGAGTGGACTTTGACAGTA
ATCCTTGCTACAAATATAATGTTAACAAAATATTTTCTAATGTAGATTTTCACCAAATTG
GATTAGTCCTCTTAAATAACAAGATAGCATTGGTGAGGGGCTCGCTGCACTAAGTGAGAT
GTTAACAAAGGTGGTACACTGTGGACTGAATCTCTTGTCACCATCGCTTCTTCACCATGA
CCAACCTAGCCTCTAAAGGACTATGAAAGACACATGGAAAAGATTCAGGCCCTCTGAGGC
CTTCCAAGGCCAGTCAGCCTCTACCCAACCTGCCAGCTGACCTCAGGCACACAGGTGAGC
CAAAGCCAAGATCAACGGAGCATGACCCAGATCAGCAGAACTACTCAGCTGACCCACAGA
ACAGTGAGAAATGTTAGATTATTGTTTTACGCCATTATGCTTTGGGATGTCTTGTTATAC
AGCAACAGCTGACTGATATAACCTCAATTGTAACAACGATGTTTACTACTCATGAATCCC
CATTTGAATGAATATGAAGGCTTTTCCTCCTAGTGGTTTAGGCTCTAGGCTCTGGAGCCA
AACTGCCTAGGGGTTCAAATCCCAGTTTTTATACTTATTTAACTTTTTCTAGTGCCTAGC
AACTAGTGCTAGGCATGTTGAATAAAATGCTATGTTGCCAGCTCTGTGGCAAGGGGCACA
TGGGATCTCCTTCTAGCCCTTCAATAACTTAGTGAAGCAGGTAATATGATCTCTGTTTAG
TAGATGTGGATACCAAGGTTCAGAGAAGTTGCACAATATCAAAGTTAGTATGCTACAGAG
CCACGATTATGAACTCAGATCTGACTATGCTTACTCTATTATTAATACCTGGCCACAGCA
TCTTAGATAGTTTGGCCTTTTGTGGATATTTGGTCCCATCATCAGCTTTTGCCTCCAGTA
GGATTTTTTAAAAGAAATTTAGAAATCTAAGTAGTGTTACCAGAGCAGGAGAGGATGCAA
TGGAGAAAAATGTGGACCGTGCCAAGCACTGGGTTTCCCCCTTAACTTGCCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved