Microcebus_murinus Locus Mono:247:SNORD58
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:247:SNORD58
Microcebus_murinus
Mono:247:SNORD58
GeneScaffold_3938
SNORD58
1001..1066
2066
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAAGTTCCAGCAGGTCC
CTAAAGTGAGTGACCCATGAGAAAATGTACTACATTCCAAAAGAAATGCTTGAGTTTTCT
AATTTATACAGGCAGAAATCTGGAGGAAGCATATAAGAATAGATATTAAGAATATAGGAT
AATGATGGGGGCTTTGGAATGTAATAAAGTTTAGATGAGGCCATGAAGGTAAAGCTGCCC
ATGGTGGGATCAGTGTCCTTTAAAGAAGAGAAAGAGCCCAGAGCTCTCTTTATCTCTACC
ATGTGAGGATAGAGCAAGAAGGAGACCATCTGCAAACCAGGAAGAGAGCCCTTGCCAGAC
ACTTTGGTATTGGCTGGGTTGATTGACACAGACTACCAAGGGGAAATTAGACAACTGCAC
CATGATGGATGCAAGGAAGAGTATGTCCAGAATACAGGGGATCCTTTAGGGTATTTTTCA
GTATTACCATGCCCTGCAGTTAAGGTCAATGGAAAACTAAAACAACCCAATCCAGGCAGG
ACTACTGATGACCCAGACACTTCAGGAATGAAGATTTGGGTCACTCCACCAGGTAAAGAA
TCACAACTATTTGAGGTTCTTGCTAAAGAAAAAGGGAAGCACTGTGATGATGGCATTTCT
TAGGACACCTTCGGATTAATCATGAAAACAACTACTATCTGAGCAGCTGTGGGTGGAAAT
TAAAATAAATAAATAAACAAAAATTTAAAAAAAGAAAAAGGGAAGCAGCTAGTTATAAAC
ATTAGCAACTGGGGCCGGGCAAGGTGGCTCATGCCTGTAATCCTAGCACTTTGGGAGACC
AAGTAGGAGGATTGCTTGGGACCAGGAATTACAGACTAGCCTGAGCAACAACATAGTGAG
ACCTCCATCTCTACAAAAAATAGAAAAATTAGCTGGGTGTGGCATCACATGCCTGTAGTC
CCAGCTACTTGGGAGGCTGAGGCAGGATGATTGAGCCCAGGAGTCTGGGGTTGCAGTGAG
CTATGACAATGCCATTGTACTTTAGCCTGGGCAACATAGCAATAGCAAGATTCTGTCCCC
AAAATAAATAAATAAATACCTACAGGCTACCACCATATGACCAGTTACAGAGATGAAAAC
TGTAATTATCATGAATGTTTCAGCCTTATTTTGTTCTGAATATGTTTGTTGGTAGAAATG
AAAACAAAGATACTTAAAAGTATTTTTGTTTTCTTCCCTCTCTTATTTTCCTATCATGTG
ACATAGATATACTGACTCTATATATTGCAGCATTTAAGTATCGTTAACTTTACAACATAG
TGTTTAAGTTATGGGATATCAAGGAGAAGGGTAAACATCATTCAAGGAATTTACCTCCTC
TTCTGGGGAAAAGGTTGGTGCCTTTCCTGTCGTATGCGGGGTGGTCCTTATGACCGTTCG
TTTTAGGTGTCAACCGACTAGATTGAGCAATGCCTAGTTGGCTGGCGAAGCGTTGTTGCT
GGGGGAGGGTGTGAGGATGTTGCCAAAGGAGACTGACTGGCCTGTGAGCCGGTGGACTTG
GGGAGAAGACCCACCCGCAGTGTGGGAGGCACCATCCAATGTGCTGTGGCATGGCCAGAA
CAAAGCAGTGGAAGACGGGGGTATTGAGCTTGTTTGGCTTTCTCTCAAGCACTCTCTTTC
TCCCTTCCTCCACCTCTCTCTCTCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved