Microcebus_murinus Locus Mono:53:SNORA35
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:53:SNORA35
Microcebus_murinus
Mono:53:SNORA35
scaffold_6404
SNORA35
1001..1127
2127
CAGAGAGATGATAATGGTGATTCACACACCAAGGGTTGTAATTAATCCAGTTCTGTGCA
CTTGAGGCCAGACTATTCTTACAATTTGAGGATGGCTGAGCACCCAAATGGGAATCATTT
GGTAAGGTAGCATACCAGGCTAGGGAAAAAGTAGAAAGGGAAAGTAGAAAGGCTTGTTTT
GATGGGAACACTATTAATTTAGAGTAGTGCTTGGTTCATAAAATTTTATCAATGTATATT
TGCTGACTTAATGAAGCAAAAAATGGAGAAAGAAGTAACAATTATTTGCTAGTGGCTGCT
TGAAGTGGCATATTCTCAATCATAACCAAGAGAAAAATGGGAGCTTCATCAAATGGATAG
TTTTCTGTTTTGTACATTTGGGAGAATGTGAGTTCCTTCCAGATGCACAGGAAAGATATG
TCATTGTCTTTCGCATAATTCAAAGATAATAATCTACAAATTATTGTTAGGAAGTATTAG
ACAATTTAAAATAGTCATTCAACATATAAGGCATGTAAACACTAGGTATAAGCACTTTGC
TTTTATAAGGGAAACTATAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGACTGGACTCTTTGCAAGTTCTTTTTTCTAATTCTCACAACCATCAATGAAGTAG
TTATTACTGATCCCATTTAATATGAGTAAACGGAGGCTACAAGTGCTTTAATGAGTTTAC
CAAAGTCCCATAGCTAGCCAGTGACAAAGCTGGGATTCTGAACCCAGAACTACCTGATTC
TAAACTCACACTTCCTTCCCCTGAAATTGACCGATGTGTGCAGTCGCCATACTGAGTGAA
TGAGGCAGTGGATTCTGAGATGTTTCTGGTCTCCTACCCATCCCTCCTCCAAACTTTTCT
TTTGCACAGAGCACAGGGTCCTAACCTCAGCTCTGTTGCTACAGCACTGGCAAGTGACCC
ATTGGGCTCCCCTTTGACCAATTGGGCATCGAGCAGTGCAAAAGCAAATCCCTCTGGAAG
CTGGGAGAGTCATCTGTGGACTACTTCTGCATACAGATGGGTACATCTCTTCTGAGTCCT
GTGACTGTGCCTAAGAAAAATCAGGGAGTGGAGAGATGAAAGAAGCAGCTCAGTGACTGC
TATTACTAAAAAAGGGTGACTATGTCCATACCCAGTTAATAGCAGGTAGTAAGTAAATGT
TATCCTTGTTATTACATTATTACATTATTATCACCATTACTAGCTGTAAGCTCTTAGCAA
TTTACATCAACCCCTCTTAGACTCAGTGTTTTAGTCCATAAAGTAAGATCGACACTGCTG
GAATGATCTAAGATTGTCACGGTGATTATATGACAAGATAAATCCATTTAACTTTTTCTG
GCAAATTGCTCATTAAGTGTCAGTAAGACAGAGAGATAAATGGCTTTCTCTTTTTGATGT
GGTGAAAACGAGATTATAATTACCTTGCAGATGTTGGCTCCCATGTATCTGCCCCACATT
CCTACTAGCTTCTTGACAAACTAGCCTTCCCCAGCCTTTTCATTCCTTTTATATAAACAG
GAGGCTTAGATCTAGAGCTGACAGAATTTTTTTCCCAATTCTTTCTTACTAGTTACAGCT
GTACTCAAGGTTCAATCCTGGCCCTTCTTTCCTTCAGAATACCTTTGAATACTCAAGTCC
TCACTAATCTCTCCCTTTACCACACAGTCTGGTAATGATCAATTTTTCATTTTTTTGAAT
TCATTTACCTTGTTAACCTATTACCTAATTGGCAAACTCTTTGAAAGCAGGGAGTCTGGT
TTCTCATACATCTTACTACTTACTGCAGGATCTAACCCAGTGCCTTTCACTAAGAAGGAG
TTCAATAAATAATTATTACTGGTTAAATTCATGTAATTTATCTATGAAGTCAGTCATCAA
TTTTTGTAACCAGAACTAGAAGAGGGCTCTAGAAAATTGAATGCCATAGCTTTAGCACCA
TATAAAATAAAGCACTGTTTTATGTGGTAAATAAAATATAGACTGAAAACTCATTTAAAA
TCTAGAAAAGATTAGTTTGCGAAAGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved