Microcebus_murinus Locus Mono:63:SNORA44
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:63:SNORA44
Microcebus_murinus
Mono:63:SNORA44
scaffold_78527
SNORA44
1001..1129
1919
TTCATTGTCCTTGCCATTTCTCGGGAATAGCCAGAAACCTTTATTAGAATTGGCTGCTT
CCACACTAGCAGAAAGCTGGGGTCTTACTCGTACAGTTAACCAGAATAAGCCTTTGGGGA
AGTATTTTGCCTAGGCCAAGAACCAATAGGGAAAGGCAATTGGGAGTGGGTTGGACATGC
CTACGGGGAAATCAGTGCATGTGACGTAGATCAGTCACTTACCTGAAAAGCTTAAGGCAT
CAGTATCAGGACCAAAATGAAGGGAAGAAAGAAAGAGATCATTCAGCCAGGCTCGTTGCT
CACGCTTGTAATCGTAGCACTCTGGGAGGCCAAGGCGGGCGGGTTGCTCGAGGTCAGGAG
TTCAAAACCAGCCTGAGCAAGAGCAAGACTGCGTCTCTATTAAAAATAGAAATAAATTAA
TTGGCCAACTAATATACATAGAAAATATTAACCGGGCATGGTAGCGCATGTCTGTAGTCC
CCTCTACTCAGGAGGCTGAGGCAGCAGGATGGCTTGAGCCCAGGAGTTTGAGGTTGCTGT
GAGCCAGGCTGACGCCATGGCACTCACTCTAGCCTGGGCAACAAAGCGAGACTCTCTCAA
AAAAAAAAAAGAGAGATCATTCAGGATAATTGTTCTCATTTTAGTTGTGTTCAATGAAGA
TTCCAGGATGACTGAAGTTGATTTTCTTCGGGTGTGAGGACTCCAGAGATCATGACAGTG
ATGAGACACAATCTCAGGACACCTGGGTAGGTTTGTTTTGGAGACCTAGTTTGGGAGCTG
TGGGGACAGTACAGCATGTTCCCAAGGGCCTGTGGCTGGTTGTGGCCACGGGGTCTCCAA
CTGCATGCGAGAACAACCTGAGAGACTTTGACAGCTCGGGTCAGCACATACCTGCAGCTG
CCACTCGCTTTCCTATAATCCTATACTGTTTCAGGAGCTGGCATTTTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved