Microcebus_murinus Locus Mono:180:SNORD77
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:180:SNORD77
Microcebus_murinus
Mono:180:SNORD77
GeneScaffold_144
SNORD77
1001..1068
2068
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATGTGAA
AATATGATATAAAATATATATTCCTGTGAGGTGAAAATAGTATTTTATTGAGAAATACTA
GGTGCCCAAACTTTCAACTACCAACTTCCTTAAGCTCTCAACAGTGTCCTAAGTACATAT
AACTTCAGGCTAATATTATTCACAACAGAATGGAATTTAGGAAAAGGTAGATCTGAAATA
AAAGCTTATATACAAACATGAAAAGTCTGAATGTATATAACTTAGTCTCAAATAGCTTGT
TAAAAAAGTGTACACACACATTGAATAAATAATAAAGGAAACTCGGTAAAAAGTCAACAG
GTAAATCTGGGTTATGGGTATATGGTTATTCTTTGTACCATCCTTATTCTTACAACTTTT
TTGTAACTTTAAAATTATTTTCAAATAAAACATTAAGAAAGATACCATGATGGTTGCATA
GTTCAGCAGATTGAATCATGAAGAGATTTACCATTTGTCTGATGTATCTGGTGGAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATTAAGAAAAAAATTTATGGTCCAATTTT
GAGGTATGGGAGAGAGAGAAGGAAGGGAGAGAGAAGAAAAGGCGCAGATGTTAAGTTTCC
AGACAAGTACACAGGAATCCCCTGAGGCCTAGACCCTATAACAACTTCCAATTCTGATAC
TGGCTGTCATCTTTCATTAATTACAGGAAGAAAGATTTTATATGGCCAGGATTCCAGGGA
AGAAAGTGCTCCTTTCTGGCCTGGGTTTGGAGACCCAAACCTTGGTTCAGAGAATAAGGC
CACCCCCCCCCTAAGATATGCTCAATTTTCAGACTATTTCTGGAATGATGCAGAGAGGCT
GAAAGCAAAAAGGGAAAATTCAATCATATCTGATAGATCCAGTTCCAGGCAAACCCAGAC
AACCTGATTAATGGAATAGCTATGGTTAAGAGTTTAGTCTGTCAGAACTATGAAGGGTCT
GAGATTTTATCCTCCTTGTAAGCTAGTTTCATGGTTCCTGACAGAAGACCTGAGACGCCT
GGGTAAGAAATGAAAGATTTTATTACTTAACAATAAAAGCAGGAGTCAGAATGTCAGATG
TTTGCAATAGTTGAGGAGTTCCAATTTCCACAGGAGTGATGTTAATGGACCTAGATGAAG
AGGGACCAGCACTTGCAGTGTGTTGCATTACAGGAAGAGTAACTCTGAGCTTTGGGTACC
AGGTTGTTTCAGAGCAGGAAATAAAGCAAGTTTACTCTTTTGTCCTGGAGGGAGCTATTA
TCTCCTCCCTCCAGGTTGCACAATTGCAAAAACAATTCTGAAGAAATGACCCTGAAAAAG
AGAGGTTGGGGCCTTGCTGGACCACAAGAAATCTCAGAAGACTGTCACTAGCAGAATCCC
CCCTCACCCACAAGTTAGATGACCAGAGTTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved