Microcebus_murinus Locus Mono:314:SNORD47
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:314:SNORD47
Microcebus_murinus
Mono:314:SNORD47
GeneScaffold_4395
SNORD47
1001..1069
2069
GTTTTTACAATGTGCCCTGACAAAACTCGCTAGCCTGCGAGCAGGGCTGCTGCAGTGTG
GGGTAAATGAAGGTACGAGGGAAGGTGCCTTGAGAAAAGCATGAAGCACAACATATGCTC
AGCCTCTGCTGACCACGGCGCGGGAGGTCGTTTCCTATCCCTGATTGTTTAGAGATGAGG
GGAAGAGGCACAGGAGAAGCTAGGTAACTCGCCCACGCCCACCCTGCGGTTAAGCGGCAG
AGCCCACATGCTGGTCCAGGTGAGCCCCACTGCAAGAGCAGGGCTTGGGCAGAGCCCACA
TGCTGGTCCCAGGTGAGCCCCACTGCAAGAGCAGGGCTCGGGCAGAGCCCACATGCTGGT
CCAGGTGAGCCCCACTGCAAGAGCAGGGCTCTTAACCTTTCCCGTGGCTTCCTCATCAGC
ACTGCCTTCGACGGCACCCCCAGAGGGGTCACGCAAGATGGAGATGCTGCACGTAATGAG
CAGTGTGAGCGTGTGGACATCACCAGTGGGTTCCTTACAGGGCCCACAGTCGAGGGACCC
AGCACCGGAGACACCTGGCTTCTTCTATGATAGATGAGAATGAGAATTATGTAATTTGTG
ATTTTGAGGGATACTCTTCATCTGAAAACTAATGAAGGTGGTGGTCACTGGGGGTATGGG
ATAATGATGTGGGAAAATGAGAGCCTTATTATCCTAAGATTTCAGGAAAAAAAAATAGGA
CTTTAGGTATATAATTCACTTTCTTATGGGTAAAATCTCCCTCTGCCATAAGCTTTACTT
TTAATTTTTTTGGGGGGGGGGTCTGTACATCTAACCGATAACATCTATAAAATTCTTTAC
TTCTGGCCAAGATTTTTCCAATTCGGAAAAATCCTTCCCCTTAGGCAACCTCCCGAATAG
CAAATACGCAGATCAAGGTACAATTTGTATCTGTTTGGAAGATACCATCTCTCTATCAAT
GCAGGGCTTTATTAACAGTTATATTAGAAGTAGAGGACTTCAACCAATGATGTAATGATT
CTGCCAAATGAAATAGAATGATACCACTTAAAAAAATTATTTTAAAAATTAAAAAAAAAA
GAAAATTAAAAAAAAGTAGAGGACTTCAAAGCATTAGGATGGGAGACTCTGTTTCTTTAT
TTAGTTGAATATGTCTCTGTTCTCAATTTTTAAAAAGGCAAATACAGAACTTCTTAAAAT
GGATATGAACAAGAAGATTACAAGTAGAGAAAAGAACAAGAGACAACCTAGCTGATAAAC
AAGGAGGTCGTCTAGCCAAAGTCAGCATTTAAGAATCTGGGTTCTAAGACCTGCTTCCTC
CATCAATTGCTTCTAAACTTCTCAATGTGCTGGGCCAGTAACAAGGCTCCCATGCAGGAG
AAAGACACAGAGTGAGAGATTCCTACAGGAAAAGTAAAACAGAGAGAGGTTTCATACACT
GTTTCATATACTGCTGTTTCAAAGCTCAATTCAAAAACGTGAGCAAAGGAACCATCCACT
ACAGCCAAATACAAGCATTATCCAAGAAATATACAAACTACGTTTATATCCTAGAAACGG
AAAGCCATTTCTGAGGAAGAGGGAGAGTAAAGGGAGGCCCAATTTTAATGTCAGTCACCA
AACATGACTGACCTTAGTTCAACCTTCACTGAACGTGAAGGGCCTTAGTTCTCAAGAAAT
TAAGCTATACATTTCTAGATCATCAGAGGGTAGAAAAACAGAATTTAAACTAAAACCTAC
AGTAATAAGGCACAGAACAGGCACATTATTTTTAGCATTTAATGGAAAAATATATATATA
TTTATATATATATAAATCACCTGAATATCATTGTGATGGTTAATTTCATGCATCACCTTG
ACTGGGCTAAGGGATGCCCAGATAAGACATAATTTCTGTGAGAGTGTTTCTGGAAGAGAT
TAGCATTTGAAATGGGTACAGTGACTGAAGAGCCATCCTCACCAACGTGGGTGAGCATTA
CCGGCAGCTGAATAGAACATAAAGTCAGAGAAGGGCAGATCTGCTCTCTGCTTGCATGGG
GACATCCACCTTCTGCTCTCAACACCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved