Microcebus_murinus Locus Mono:111:SNORA42
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:111:SNORA42
Microcebus_murinus
Mono:111:SNORA42
scaffold_1387
SNORA42
1001..1123
2123
TTCCTAAAAAATAGAGATTCTCAAGTCCCCTACTTGGAGATTATGATGCAGAAGATACG
GAGTGATTCCCTGGCATTTGTTTGTGTGTTAGGTGTGTTTGTTTGTTTGAGGAAAACTCT
AAACATGAGTCTGATTATTAGCTGGTTTGGGAAACCTGGCTCCAGCTTCCTAGAGATGAA
CTCTTTATTTCCTCCCATCCCTGGCTTCACTTAGAAATGGAACTCAGTAATTACTAAACT
CTCACCTTTTCCACTCAGCCAACTTGCCTCTTGTACCCCCATTACTTTGCACTCCACCTT
GACAACTGCTACGGCCAACCATCAGTAGTAATCCATTTTGACATCCTCTCCTTTCCACCT
GCTGCCCTCTAGTGGAAGTGCTGACAAGCAGCAAAATATTTAACCGGGAACAACAGGTGA
GTGTCCAGTCTGAGCCGGCTAGCTCACACAGGTCAGTGCAGGTCTCCGCTGAGATGTTCA
GAAACCACAGCTATGCTAGGAATCATTAGGATAGCCTCAAGATGTTTGGACACTATTTGC
ACACAAGTTACATTTAGAGCAGAGCTTTATAAAGACCATGGCATCTATTCATGGGCTTTT
TCCAGATTTCAGAAATCTACCTGGAAAAGATCACCGATATTTGGCTTCTTTGTCCCTCCT
TTCTTCTGTCATTGACTTACATTCTACCTCTTGCAAAAGAAGGTACCAGTAGTTCTCCCT
ACCTCCAATATTTTGGATTTTATAAATCTTGCAAAATGATGTGTGTATATAAATATTTCC
TATAGTTTAATATATACATGTGTAATATATATAATATATATATAATATGATACACACACA
CACCTAATGGTTTACAGTAAGGATTTATAGAAGCTTCCAGGCACCAGGTGAAAGGGACTG
ACATGAACTGAGCATTGACAATGTAAAGGGCACTTAGTTGATATGTTCTCCTTGCATCCC
TCCAAGGCTCTTTGAGGTCCAGTAGTAGTCCTGTTTTTCCCACGAGGAACTGAAGTTTAA
GAGAGTTCAAGAAGATTGTGGGTCCCATGCTAGAGCAAACTGGCCCCGAACCATTGCCTG
GCCTGTGCCAGTAGGCTGCTGGCACTGAAGTGGGTTGCACAGTGGGTTGCTCTTGAGTAA
TGTAGACGTGATTTTTAAATAAGTTTGAGACTAATAAAGGTGCTTTTATATATTGCTTTT
TCTTTGCATGCTTCTGTCATAATATGTTAAAGTATATACATGTCAGCCAGGCGCGGTGGC
TCTCGCCTGTAATCCTAGCACTCTGGGAGGCCGAGGCGGGAGGATCACTTGAGATCAGGA
GTTTGAGACCACCCTGAGCAAGAGCAAGACCCCATCTCTACTAAAAATAGAAAGAAATTA
ATTGGCCAACTAAAAATATAGAGAAAAAATTAGCCGGGCATAGTGGCACATGCCTGTAGT
CCCAGCTACTCTGGAGGCTGAGGCAGCAGGATTGCTTGAGCCCAGGAGTTTGGGGTTGCT
GTGAGCTAGGCTGATGCTATGGCACTCTAGCTGGGGCAACAGAGTGAGACTCTGCCCAAA
AAATAAATAAATAAATAAATAGAGTATATACATGTCCTTTGTCATAAAAAAAAAAAAAAA
GAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAAATCATTCGACTTTTCTTTCAATGAGTGTTTAATAATAAGTGTGTCTCT
GCACAATCCCCAATTCCTATTTTAATACTCTTGCATCCAGAATTGTTAGCAGAGAACTTT
GGTCAGGAGTAAGTTTGGGTAGGAGGCAAAGAGAGCAAAAGCCTCAACTGATGCAAAGTT
GAGGCTGAATTTCACAGGATAGATGCCATATACTCCTGCAGGCTTGGAAAAACAAAATAG
TTATCTATATTAACCAAGAGAGCAGAACTCATAGTTCAAACACTGATGTAAAGCATGTGT
GTGTCCATCCCTCACAGGATCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved