Microcebus_murinus Locus Mono:76:SNORD78
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:76:SNORD78
Microcebus_murinus
Mono:76:SNORD78
scaffold_4769
SNORD78
1001..1065
2065
GCTAGTCTCACCTCTTTGAAACCTCATTTTCCTTATTTTTCTGAATAACTCTTATTCAT
CATTCAGGATAACAGCCGGCACTCCTTTCCTTTCCTGGATTAGGGTAGAACTCCTAACTA
TAATGCTATCTAAACTCTTTATAACTCTGCCACTATGGCATTTATCCCATATTTTGTGTT
CATTTGTTTCATCCTCTGTCTTCACCACTCTATTGTAATGTGGTGAATGCATTGCCATCT
CTATTTAACTTCTTACTGTATTCCTGGAGCTTATCAAAATACATAACACATGGTGGGCAT
AGGAGTACACCTTTTAAGTAAGTAATTAATCTGTTTACTTCAATATTTCTATTGCCTTTA
AGAGAAGACGTATTTACTATTTATCTTTAGTAAAAATAACTAAAAAGTTAATTTTTAAAA
TAGTCATAAATATTTGTTATGCTCCAAATATGTTGTTCTAGGTGGCATGCAGTTTTCAAA
GAAGTATAAATGAGGGTTCATTACTTCATTGAGAATAATGTCTAAAGGGGCAGACAATTG
ACAGTGCAGTTTGAAAGTATGAAAAGATGACAAAGCTGTTCAGGTGACGTTGTGCAGTGC
CACTGTTAAGGGTTCTCATATTAGTTTTTCACACAACTAGTTTTTATAGTCTGAAAGTCT
TCTGACATATTCTTTAGTTCCCTTTGAAATATTTCCTTTCAGAGTGGTGAAATTCTTATT
CACACACGATAGCTATTTTTAGGATCAAGAAGGTCAAAGGCATTAGATTTCTTCATTCCT
TTCCCACCATAGGTTTAAGAATTCGCAAACCAGCTTAACAGCTTAATAGAAGATTGACTC
CTTCCCCTTCTTCCTAGAAATCCTCTCAAGGCAGTCTAAAAAGCATTTCCCAGGTTTAAT
GTTAAAATACAAAATAGCACACTGAACTCCTAGGAGTTGTCATTCTCTGTACATTCTGGA
ACCAGGCTCTATTTTGAAAATTATGGTAAGTCAAAGTTTCTCTGCAATGATGTTGATCAA
ATGTCTTACCTAAAATGAGCATGTAGACAAATTTAATACTGAAGGAAAAACATGTCTCAT
AAAATGAGAAGGCACTAGGCAATACTCTGTAAGTAAGGATGTCACATAACAATGTGTGGT
TTGATCTCTTGGAACAAAATTGACACTAAACTAAAATGTGCCACCTTTGGTAGAGTGGAG
TGAGTTTTAGACACAGTAAGTTGACTTTGATGACCTAAGGGGAAAGAGAGCCTGTGTCAC
TCAGCTCCACAAATTCTGCCACCATGAAAAGTTTCTAGGAGGTGGCAGAACATGTTTGTC
TCCTTTTACTTGACAAAGTGCTCAAGAGTAATTTTCTTGTTCCAGGTGAAAAGAAGCAAC
ACACTTCCTTTCTAGACAAATTATTATTTTTTCCAAAAAAGCACACATGCACAAAACAGT
GATAAAAATACAAACATATATGCTGCTTCCTATTAAAGCTTCCAAAGACCTCAAAACAGA
AAAATGTGAGAAGGCTTAGCCAAGAAATGTATTGAAGATATATGGATTCTCTTACTTTCA
GGCAATATATGATCCTGGGGTAGGGCTGGGGGGATAGGTGTTGTTCTGATATGTGCTGGT
GCTGTGGTGAGGTTGGAGGTAGGCATTGTTCTGATAGCTAATGTGCTCAGAAATTGGGGT
CCTTTGGGGTGTGGCCAGAAAAAGGAACAGCAGTTTTGTCCAAGGACACAGCAATGGCAA
GAAGAGTAGCAAAGACTAGGTGTATGTTCTGGTGTGTTGACACCTTTTCAGACAAGGTTA
GTCTGCAGAAGAAAAGGCTTTTAGTAGAGCACAGTCAAGATTGCCAATCGTGTTGAGATG
TTGGGCTACCCAAGCACGTCACAAATAAGCAGGAAATCAAGTACTGGAGCTCATTTGGGC
ATAATTACCCAAAGGTGCTTCTAGCAAAGGTGGTAGATTGGATGCACACATTTATCACTG
TGTCCTTCCTAAATCCCATAAAATAGCCAAAAGAGTGTGAAACCAACCCAAAAAACAAAA
AAGAACTGAAAAGGAAGTGAAAGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved