Microcebus_murinus Locus Mono:308:SNORD16
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:308:SNORD16
Microcebus_murinus
Mono:308:SNORD16
GeneScaffold_585
SNORD16
1001..1087
2087
ACTTAAGGTTACTGGGGAAGTACTTAAAAATGTTTATTTGAACTGTGGATAGTTGACTT
AAGTTGGTCACAGTAGTGATTTAAATTTCCCAGATAGAATATTAGTTAAGCTATATTTTT
AGTTCCAGGAATTAGCATTTATGTAATAGATTTTAAACATGATGTCTTAGCAGAAAATAG
TGTTATATAGTAATTCTGAAATACATGGTGCAACATGTTGATAAAAGGGGCTTTTCAAAT
TAGGATAAAAAAGAATGTGAATAGTTTATAATGGCCTGTAACCAGTGTCAAAGTCAGAAT
CTACATCAGAAAGTGATTTAATTTTAATTTTTCCTCTTTTCTTGCCTCTGTGGTAGAAGT
TCCAGTGAATAATGAAGTAGTCAAAGGTGAATGCAGGCTGGGCATAGTGGCTTTCACACC
TCTTATCCTAGCATTTTGGGAGAGGCAGGAAGATTGCTTGAGACCAGGAGTTTGAGACCA
GCCTGGGCAACATAGTGAGACCTATATCTACCAAAAAAAAGTTAAAAAAAAATTAGGTGG
GCATGGTGGTGCAGCACTTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGATCACT
CCTGAGCCCAGGAGTTCAGACTAAAGTGAGCTATGTTGACTCGACTGCACTGCCTGGGTG
ACAGATCAAGACTCTGTCTTAAAAAAAAAAAAAAAAAAAGAAAGAAAGAAAGAAAAAAAG
TGAATTCAGTAGGAGGGAGGAAAGAGAAAGGGAATTTAAATAATCTAAATTTGAATATTA
TAATTACATAGCCTTATTAAATGCTTTGAATTGTCCTACCTGATTGAGGCGCTAGACTTC
ATTGGTTTTGGAGTTGTCCATTGATGTTTTTATTTTAAGTAAGAAAATAATTTTAGCCCA
GTAGGTGGCATGTACTGATTATACACTAATTTTTCAGTTGATATATTATATTTTTCTGAA
TATATTTAAAATATATCCTGTGGTTAAAACAGTCTATCACTTGCAATGATGTTGTAATTT
GTGTCTTGCTCTGTTCTCAGCAACAGTTGCCTGCTATAAAGAAGGTTGACAAAAATTCTT
ACTGAGCAAGACATAACCTTTTTTAATTCCTAAAACTTGAGAAATGTGATTCCTAACTGA
GGAAATAGGAAAAAACATTCATCATTTTTCAAAGGGAAGAGGAAGAAGTTAATTTGCTTT
CTTCTTTTAAACTCCAACCGAAGGGAAAAAGTGAAAAAGAATGTAAGTGGTTAATTAAGT
TTTACTGCTTTTGTATTTTCTCCTCAGATTTCGGGATATTCTTACTATTTCTTGCAAAGG
TTCATTTCTCTAAAATGGAAAGTTGGTGTGGTTAGTGCAAATATATTTTAGAAGAAAGGA
AGTCAAAACCTAGCTACAGAAATTACTTTAGTGGAAGACTTTCCCAAACTATATATGAAG
ACAAAATTCCTCTTTCTCTCTGTACCAAAGATAAATCACCCCTTTGTCTACCTTTGTGGA
CTTATATCTACCTGTAGGTAAACATATTCTACATAGAACTGCTGGTGCCATTATCTACAT
ATATCTGTTGGTTTTCTTCTCTCAGAAATATTCTCTTGTGAGAGCAAATCTTTACTGTAT
CTTTAGACATACTGAGTCCCATTTAACAGGGAGAGTTAACTTTTTGAGGTATATTTCCCA
ATTAAGGACTAGGGAATAAGGAACTTCAAACTGCTCCCTTCCCTTCATCTCTCAAATTAC
CACCACCTTCTAATTCTCTATCCAGAAACTTGATTTAATAGGTTCATTGTTGTAGGTACT
GTGTTTAGCTAAATCTTGTATCTTTTTTTCCCTCTAGGCTACTTCTACATAGACATAATC
AGTGTTGACTATTTGGAATTGAAGCATCATTAAAATCTTCTCAAACTTCTCATTCCAAAG
AAGTGATAACATTTTTCTGAACAAGAAAAGAAGTGACTGACTACGTGTTAAAAGTATTCT
GGCAGTGGTCCTGTTTTTTTCCCCCGCTCTAAATTTGAAGAACTATGGAGAAGTGGTACT
TGATGACAGTCGTGGTCTTAATAGGACTAACAGTACGGTGGACAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved