Microcebus_murinus Locus Mono:27:SNORA36
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:27:SNORA36
Microcebus_murinus
Mono:27:SNORA36
scaffold_27068
SNORA36
1001..1132
1547
GTATTTTCTTTTTCTGACTACAACCTTTGTAATTGGTTGGTTGTCGTAAATCAAAGTTA
ACCATCTCATCCTTCTGAGTTAATATTAGTTAAAATTAATATTAATTTTTTCCATGTAGG
CTGGGTGTGGTGGCTCACACCTGTAATCCTAGCACTCTGAGAGGTAGAAGTGGGAGGATC
ACTTGAGGTCAGGAGGTCGAGATGCTGTCTCTACTAAAAATAGAAAAAATCGGCCAAGTG
AGGTGGCACCGTCTGTAGTCCCAGCTATTCGGGAGGCTGAGACAGGAGGATTGATTGAGC
CTAGGAGTTTGAGGTTGCTGTGAGCTCTGCTGACGCCGAGGCACTCTAGCCCAGGTGACA
GAGCAAGACTCTTGTCTCAAAAAAAATTGTTTTTTCCGTGTAGTTATTTTTAAATGTTCT
ATACTCTTCATAATCTAATTGATGTACTCCCTGTTCTGTTAATTAAACTTTGGGACATTG
ACATGGGCTAGGGGAGATGACTGGATAGAAAGCACTATTCTATTCATTTACCTCTTAGTC
CTACAAAAATGGAAGAGAAAAAAAAAGGAAAAGAAAAAAAAAGGAAAAAAGAAAAAGAAA
AGAAAAGGAAAAGAAAAAAAGAGAAAAGAAAAAAAAAGGAAAAAAAAATAATTGATGTAC
TGAGTTTTCTTGAGTATTACTACATTAGATTCTTTGTTTGATTTCTCATTTCGATTTGTT
GTTGTTTTTTTTTTGTTTTTTTTGAGACAGTGTCTCACTTTGCCCAGGCTAGAATGAGTG
CCATGGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGTTCAAGTGATCCTACTGC
CTCAGCCTCCCGAGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGGCTAGTTTTTTC
CATATATATATTAGTTGGCCAATTAATTTCTTTCTATTTATAGTAGAGACGGGGTCTCGC
TCTTGCTCAGGCTGGTTTCGAACTCCTGACCTTGAGCAATCCGCCCGCCTGGGCCTCCCA
GAGTGCTAGGATTACAGGCGTGAGCCACCGCGCCCGGCCTGTTGTTTTGTTTTTTTTGAG
ACAGAGTCTCACTCTGTTGCCCGGGCTAGAGTGCTGTGGTATCAGCCTAGCTCACAACAA
CCTCAAACTCCTGGGCTCAAGCAATCCTCCAGCCTCAGCCTCCTGAGTAGCTGGGACTAC
AAGCATGTGTCACCATGCCCAGCTAATTTTTTCTATATATTTTTAGTTGGCCAATTAATT
TCTTTCTCTTTTTGTAGAGTCCAGTCTCACTGTTGCTCAGGCTGGTTTCAACTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved