Microcebus_murinus Locus Mono:86:SNORA29
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:86:SNORA29
Microcebus_murinus
Mono:86:SNORA29
scaffold_6314
SNORA29
1001..1150
2150
AATAAAATTAGACACTTATCTCACACCATATACAAAATTCAACTCAAAATGAACTAGAG
ATATAATGTAAGACCTGAAACTGTAAAACTACTGAAAGAAAATATGGAAAAAAGCTCCTT
GACATTGGTATCTTCAATGATTTTTTGGATTTGACCCCAAAAGTACAGGCAACAAAAGCA
AAAATAAAGGAATAAAATTGCATAAAACTAAAAAGCTTTTGCACAACAAAGAAAATAATT
AACAGAGTGAAGGAGAAACCTACAGATAGAGAAAAACTATTTGCAAACCATACATTTGAT
AAGGGCTCCCTGTCCACAATATATGAGCAACACAAGAAAGAAAAAATAACCCAAATAAAA
AATGGACAAAGGACCTCAAGGGACATATTTCAAAAACAAGACATATAAATGACAAATGGG
TATATGAAAAAATGCCCAATATCACTAACCATCAGGGAAATGCAAATTAAAACCATGATG
AGGTATCACTTTATATGTATTAAGATAGCCATTATTAAAAAAATGTAAAGTAAGTCGGTG
AGAGTGTGAAGAACAGGGAATCCTTGCACACGGTTGGAGGGAATGTAAGTAAGTACAACC
ATTATGGAAAATAGTATGGAGTTTCCTCAAAACATTAAAAATAGAACTACCATATGATCA
AGCAATCCCACTAATGGGATATTTAGGGTATATATTTAAAGGAAATATTATAAAGTCAGT
GTTTTGAAGAGATATCTGAACTCCCATGTTCATTGCAACATTATTCATAATATCCAATAT
ATCGAATCAACCTAAGGGTCCATCCTCACATGAGTAGATTAAGGAAATCTGATATATACA
CACAATGGAATATTAGTCAGCCTTAGAAAAGGAAGAAATTATTTCATTAGCAAAAACATA
GATGGAATTGCAGGATATTATGTTAAGGGAAATAAGCCTAACACAGAAAGACAAATAGTC
TATGAATTCACTGATATGTAGTATCTACAATAATCAAATTCTTTCCTCTTTCACTACCTT
TTCTCCTAATAATATATTTTAGTGGCTATGCTTATGGGATAGATTAAAATTGTCATGATT
TGTGAGAGAGGATTTTTGTTTGTTTTTGTTTTTTTGGTATCCTTCTATATGAAACGGCTG
GACAGAAATTTATTACTTATGACATTTTGACACTGTTTTAAATATAATAAAAGCAAAACA
CTGGAGTAGTGAGTTTATAAGTAAGAATTAAATAAGTATTGTTTAAAGTTAAACTCACAG
AAATAGAGAGTAGCATGGTGGTTACCAGAGGCTAGGGCAATGGTGGGAGGGAAGAATAAG
ATGTTGATCTCAGAGGGTACAAAGATTCAGTTAGACAGAAGGATCAAGTTTTTAAGATCT
ATTGCATAGCATATTGACTATAGTTAATAATGTATCATGTTTCAAAATTATTGAGAGAGT
AAATTTCAAAAAATGAATGAGTGAGGTAATGAATATGTAATTAGCTTGATTAAATCATTG
AATAGTGGTAAATGTAAATCAATTATCATATTTTAATCCATAAACCTATATAATTATTAT
TTGTCAATTAAAATAAAAATAAATTTAGAAAATAAATACTTTTCTAATAATTGCTCTAAG
TAAATAATTAGAATAAATATAAGGCTCAAATTTGCATGAATCAATTTGATATAGAGGCTG
GTTTCCTAGGTGTTCAAATAAAGGAAACTGAATTTTAAGGTACTTTTGCTCAGATCTGAG
AAATAATGAGTGATGTTTCACCTCAAGTGTATTTCTAGTCCCTGATTTTCATCCAAAAAA
AGTGTTTTATCTGCATCTTTATCTACCATATTTCTCCGTGTCCCTTGGTTCAGAGCAGCC
ATTTCATGAATTGTCACTGCAGCAACAGGAGGCCATTGCAGCAGCATGAAATGTGCTGCT
CCTCTGCTCTCGACAGTTCTGGCTACATCTAATTCTAAGGTCTCATGGTTTGGTATGAGC
TAAGGAGTCCACATTGCAAATGTCCAGTGGAGAATAAGCCTGGATGGTTTGCAGGATTTC
TATTTAATTTTTATGATGAGCTTGCACTGGGAATTTCATATCAGACTGTGTAGGGTAAAG
GAGGCTTTGTAAAGTCTAAGTAGAGAGAACTAACAATCCTGGATGCAGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved