Microcebus_murinus Locus Poly:21:SNORND104
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:21:SNORND104
Microcebus_murinus
Poly:21:SNORND104
GeneScaffold_1060
SNORA76
1266..1399
2399
GCACTGACTGATCAACACTATGGTGCTCATAGGGTAGTATTATTCTCCAGGGATTAGGG
GCTTGCGGGCAGACGCGGTGAGCATTGTAGAGGGGAAGGACAAGCCTCTAATTCTCCCTT
GGGTGAGGCAAAGACATAAAATGTAACCAAAATGTTTGTACCTCATAATATCCTGAAATA
AATTAAAAAAAAAAAAAAACAACATAAGAAACAAACATTTAGAGAACAAGGAAAAAAAAA
GTTTCCCACATCACCCCAGTCCTTTAAAAACAAACATTTATCACACAGAATGTGCCATGT
GATTGACTTTAATTCACTTAATCCTTACAACTTTAGGGGGATGTTCTTAATTTCCAGAAA
ACGAGGCTCAGAAAGGTTAAATGACCAGGGTCATAGAAAAAAAATGCATCACAAAGTCAG
GATTTGGTTGCAGATGGGTCTACTTGAAAACAAAAGCTCTTTCTACCACAACAGGTTATT
TTGAACTGGGGGGGGGGCAGTTTTGTTCCAATTTTACATCCTTAACTCCTAGCCTAGCTT
TTGGCACAGAATATCTCGTACAAGTTAGGTATTACTTGTCTTCTGTTCTTTGTAAAGCTT
TCTTTTGTGTACTACAGAGACAGGTACTAACTACAAGCCCGCGATGGAGATGTGGAAATA
ACATCCTAAGCACTCCAGTGACTGCGCCACTCTCAAAACTCTCGGCGTCTTCTAGACTCC
CATCTCTATGGTTGGTATGTGAGCTGTCTACGCTCCGGAGGACTCAGAGAGCACGGCCAA
TCATTAGATTACTTTACGTGCACGTGGTCGGAAGTTTGACTTACTATTGGTTAATAGCAG
TAAAGGCCGCCCAACCACATCCGGTCTGCTCCTTTAAGTAATCGCCATACCGGCATTTGA
GTCTTTCGGCGTCTGCAAAGGCTGGGAGGTGAGTTGTGTTCACTGGCCGGGCTGCACGGC
CTGGCGGGCCAGGAGCGGGGTGGGAGGCGCACGGCCGGCTGGCCGTGATGACATTCCAAT
TAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTGGAGTCTGAGCCGGCTGCAG
CGGAGATGGGGGTGGGACAAGCCGGCGGGCACACCCCGCTCACCCTCTACGGTTGCTCTT
ACAGGTCCCAGCCCGGCCGAAGACGTTGATCTCCGCGTTCTACGACCTTCATTGTTCCCT
GTCCCCAGTTCCCCTCAATAAAGTGTTTTAACCCCAACGCTGGTGTCGGTATGTGTTGTC
CGCGACGCGCTGCCTTTGAGCCCCCGTAGCGCCTCCGCGTGGCGCCGGGGGTCAGGCTGC
AGCGCCAGAGCACGGGCTCGCGCATAACTGGGGCCGCCTGCCTCCTCCGCGGGCGGCCCT
TTTAACCGCGAGCGACACAGCGGCAGCCCGGGCCGAGGCCTGGCTGCCGGGGTGGGCAGT
TTTCCAGGCGTTTTGGGACGACTGTGGCCGTAAACCGGCTTACACCAAGATCGAAATGTC
CTGGGTGGGTGGGGTTGACAGGGATACTGTATCCTTGGCCGCAAAGTGAGTGGTCCGCCT
GTGCACCCTTATATTCTGCCCTCGCTGAGTTGCATTGGGCACGCTGTGCCTTCCCTGGAA
GTCCCAAGCTGTCGCCCCTTAGTGGCCAGTTAGATGTGCACGTTCAGTTAAAGGCAGTGT
GGGGTGGCGAAGGGCCGCGGGGTACTTGACGGGAACCGTATCGGTCTCGAGCTGCACGAG
TTTTAACTCACGGCTAAAGTGTAATCGCGACCTTATTTACGCCTCAAGTGAACTGCCTGC
TTATTTGGGTACCGTGCGACAAGTCTGGGACTAAAGCTTTGGGCCAATTAAAGCACGGTT
GTGAAGATGAGTTAGATTTTATGTATAGCTGGGTATAATATAGAAACCTCAATAATTACA
CAACTTAAGCCTGGCGTGGTGGCTCACGCCTGTAATCCTAGCATTCTGGGAGGCCAAGGC
GGGAGAATCGCCCAAGGTCTGGAGTTCAAAACCAGCCTGAGCAGCAGTGAGACTTCTTCT
CTTCTAAAAGTAGAAATTAATTGGCCAACTGAAAATATATAGAAAAAAATAGCCGGGCAT
GGTGGCGCATGCCTGTAGTTCCAGCTACTCTGGAGGCTGAGGCAGAAGGATTGCACGAGC
CCAGGAGTTTGAAGTTGCTGTGAGCTACAGGCTGACGCCATGGCACTTTAGCCCAGGCAA
CAGTGAGACTGTCTTGAGAAGAAAAAAATGCCAAGATCTTCCACCTGGGCTTCTACATAC
TGTGTATCAGTTGTGTGTACGAGGCAGCAGTGGTGGGCAGGGAAGCTTTACATTCAATGA
CAAGGGCTCCAAATTAACAGGATTACTAGGTGATTAAGGCTGTAAGCTCCCGGTTAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved