Microcebus_murinus Locus Mono:113:SNORD56
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:113:SNORD56
Microcebus_murinus
Mono:113:SNORD56
scaffold_3094
SNORD56
1001..1071
2071
TTTCCGAGAATCTAAGGAAATAAAAAGTCAGGAAAAGCTTTACATAAAGCTGTTCATTA
AGTCGTTATTTATAACTTTACAGATTAGAAATAATCTAACATTTTTGACAGTAAGAGAAT
GCTTAAATAAGCTATGATACAGAAGTATAATGGGCTGTTATAGAACCAATAAAACTAGGA
ATATGAAGGGAATTTATTATACAGTGAAGCACAAGCATAGGGTACTACCAGAGCACTAGT
GTAGGAAAAGACAGGGCAAACATGTAGCAAATGTTAATAGTCAGGCTATAAATGTTATAA
ATGATAATAGTGGCTGTCTTTCAGTTTTAGGATTATGGGTATCTTTCCCCCTTTCTATTT
TCTTTGTAATGCACATTTTGTACATTTATTATCTAATACTTCAGAAAAAAAAACCAAGCC
ATATTAAAATAATCAGTGCTCTTATCTGACACATTTCATCTTGTTATTTGGTATCATTCC
AGTCTTCTTGCCTTGGTGTAGCAGTTTTGGAGGCCAGAGCTAGGGGAGCTCAGGATCTGA
TTTAGCGGCTCACTCCCCAGTGCTACCCTATCCTCTTCAGCTAAACTTGCAACTATCTGC
TGAGAACCTGTAATCTGCCAAGCATCATGTTAGGTGCAATAGGAAATCCAAAGAGGCATG
GCATTTTACTTTTAAGCTTATGATTAGGCTTATAATTTTATTAGGGATATAAGTCTTATT
TACTTGAAACAAAAATTAGGGAACAAAATAGTGCTTAACCTAAGGCCAGGAGGCTCCATA
GATCAGTGGCTTTCAAATCTTTCAAAGTAAATAATACACTTTACATTGCAATCCATACAG
ACTGACATGGGTTCCAGTCCCAGCCTTGCCAATTTCTAGCTGTTTAATCATAGCACGTGT
GTGTGTGTGTGTGTGTGTCTAGAAATATTATTTGCCATCTATGTGTAATGAACTCTATTT
TCTATTAATTCCTAGTCTACATTGTTACATTAAAAATACAACTATAATGATGGCAATAGT
TTTCATCAACAGCAGTTTACCTATTAAGTGTTGATACTTTGGGGCTGAGTTGAAGAAAGG
GGAAAAAAAGAAAAGAAAAATAAATATGTTGGTCACAACCCACCAAATTGATTCCCTGAA
CCTATTAGTGGGTTCTGGACCCAGAGTTTGAAAAACACCTATAGGCAATAAGCTCTGATA
AATGCTTTATTAAAAAAAAATCAGGGTGTCCCTATAAATTACTGGGAAAATCTTGAGCTT
GAAAGTAGCATTCAAAATAGTAATAGTCTCCACCTGGGAAAGACAATCAGATAAAATTAA
TCTCATAGATTCCCCTGAAGTTTAGAGCTATTGCTTATTTTTAGTAACATCCAAAGGGGC
AGCAGTGTACTTTGGGAGTTAAAAGCACTGAGTTTAGGGTCAGACTGACATGGGTTCAAG
TCCTAGCCTTGTCAATTTCTAGCTGTTTAATCACAGACAATGCTACTTAATTTCTTTGTA
TCTTATTTCTCTAATATGTAAAATAAGGGTGACTAGTCCTACCTTTTAAGAAAATTTATA
GAATTAAGTCAGTCAAAATAAATTGTGTCTGGTATGTAGTAAGTGCTTATTATGCACTCC
CTTTGTTCAAGGCTTGGTGGATTATATTGACTCCTGAATGTTAATAATTTATTTTATCTG
GTTCCAAATTCCAAGATGGTATTGACCCAAACTCATTTCTTCCTCTCATCCTATCAAATC
CAACCTGGCTTGTTTCTCCTTCTGTCTGGCTCTGAGCCCCAAATCCACAATCTGCTCCCA
ATAGTCTAGAGTAACAGAATTTTAGCAGGTTTATTGAGAAATGGGTCAGATTCCAATTCT
ATTTAAAATATAGGCTGAGCCATGTAAATATAGATTTTATATATTATAGGGATCTCTGTT
CACAATGAAAGTATTTTCATTTTTTAAAAAGTAACAAACTTGTGATAAAAATTCAAACAC
CATATATAGGAATAAAGCAAAAACTTAAAAACAAAAATCACTCCATCTCTAGCACCTAAT
TTTTCTAGTCTTACTCCTTAACAGCAATTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved