Microcebus_murinus Locus Mono:235:SNORA2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:235:SNORA2
Microcebus_murinus
Mono:235:SNORA2
GeneScaffold_1049
SNORA2
1001..1138
2138
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAG
CCACCTGCCTTGGCCTCCCAGAGTGCTAGGATTACAGATGTGAGCCACCACGCCCAGCCT
ATACCATTAACTTTTATTTCATTTATAGCTTTTATTTATACCATTACCTTTAGCATCCAT
GAGTTTAGTATGCATGAGTTGATGAGTTTAATTGGAGTATAATGAGCAGCAGAGGCATAG
AAAAATACCTACTTGCCTATAGTGCAGCCTCTTATGTAGGAAGAATAAAAATTAATCAAG
CAAGACTATTTTTTTTCCTTTTTAAAATGCACAGTAAAATGAGAGTCTTTAAAACTCTCC
CAGAAAGAAGGGATGCTACCATAACACCTAATGGGAAAGAAGGCACACTGGGCTTGGCTT
ATACTTTAATTAGCTACTTGTGTAAAAATGTTTAGGGATTTTAAGCTATCCACTGGCACC
TAAGGAGTGAGGCCAATCTTATTCTCCTTCCTGTGAGTAAGAACAGCAGACAGCGGGAGA
GAAGATGCTATACTTAGAAGTAACAGTTAACACAGCTTTCCTACGCCCTGAATCAAGACT
GGTGATTTGCTGTTGTAGCTGTTAGTTTTAAACAGGAGCCAAGAGCAATGTCTTTCTTGT
GATCTGTTGGCTATTCAGTATCTCAAAATGAATGGCTAATTCAGTTGGAAAACACATAGT
CTAGGGAAGAAAAAAACAACAACAAAAAAAAAACAAAAGAAAAAGACAGCTTTCCAAGTA
ACATTTGTGTTTGTTAGCATTTGTGATCAGTGAAATAGAAGTCTGGTAATGTTAAAGTAA
AACAAATTTTCAGCTTAAAAATATTGCCTTTATTAACAATCATAAAGGTTTTTTAAAAAT
CTTACCATTATGAAAGCTTAAAAAAATATAGCACTCAGTGCAATGAATTACTACATTTAA
TTATTATCTCAAATACTTAAGGCAGATTTCTCATGTGAGAATTTAGCATGATCCAAACTC
AAATATCCATTTCTCATATCTTTCAATGTCTGCAGCAGATACTGACTTAGAAACCTTTTT
CAAAGCCATTTCAAAATCCTCCATTGTTGTAGGCATGTGCATTTCTTCTTTTGAAAGATT
TCGGATTTCTTCTGGGGTCAAACCTTCAATACGCCTTCTCATTGCCATCAAGGATGCATC
CCTACATTTTAAGTTTAAAAAAAAACCCATTAAGTGTTATTTTGGTTGAATTAACACCTG
TGAGATTTTCAGAAAACAGAAAAAAGCCTGTGAAATGAAAAATTTTCAATGCATGTGTTG
TAACATTCTTTAATTATGATCTTATCACATATACATATGTAGTACTGTATAGAATCTTAC
TGAAATACAAGGCCTGTTGTAGATTTTAGCAGTTAAATCTTCCATCCTTAAAATAAGGAT
GCTAATCAATTTAAATAATTAACACTGAATAGAAAAGCCCAGAAAAAGAGTACAATAAAG
CTAGCAAGTGAATTTCATTACAAGTATTCAATAAAATAAGGAATACTAAATATCACAGAC
AGAAGAGAACCTATTAACCAGAAAATTAAATATTTTCTCCACATAGCATAAAAGCCAGAT
GATCAAGTTAGTGGTTTCTCCTTTTCCTCTCTATGTGCTTTACAAAAAAAAAAAAGAGAG
AAACTTCAGATTTAAGTTGTTCCTGCCTTTCACCAAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved