Microcebus_murinus Locus Mono:87:SNORA27
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:87:SNORA27
Microcebus_murinus
Mono:87:SNORA27
scaffold_15422
SNORA27
1001..1121
2121
CCCACTTGTGGGCTGGGTTCGGTGGCTCGCACCTGTAATCCTAGCATTCTGGTAGGCCA
ACGCAGGAGTATTGCTTGAGCTCAGGAGTTTGAGATCAGCTTGAGCAAGAGTGAGACCCA
ATCTCTACTAAAAAAGTAGAAAAATTAGCCAGGCACAGTGGTGCATGCCTGTAGTCCCAG
CTACTTGGGAGGCTGAGGCAGGAGGATCACTTAAGCCCAGGAGTTTGAGGTTGCAATGAG
CTGTGATGATGCCACTGCACTCTTGCCCAGGCAACAGGGAAAGACTCTGTTTCAAAATAA
ATAAATAAATAAAACCCCCTCGTAATTGCCACTAATCAGAGTGTAGTTTCAGGGCAACTT
GAATCTATGCTCTCAGGTGGGCATCCTCAAGCTTTCAGCTCAAATAAACTTTACTTAATC
AGATTTTCTGAATCTTGTTATTTAAGGTTGACAGTATCTCCAGGCTGTACCTCTCCCCCT
GATCTTTAATCATATCCAATCACCTACTCAACATCTATACATATCTCATAAACTTTTCAG
ATTTGACAGCTAAACCAAACTCCCAATTTCCCCTCCCAAATCTGCTCCTCCAGCTCTCCA
GCTGTCGCCTAACTTTTGAAAACCTTCGGAGGAGTCTTTTTATTTTTGAGACAGGATCTT
GCTATGTTGTCCAAACTGGTCTTCAATTCCTGGCCTCAAGCGATCCTCCTGCCTCAGCCT
CTCAAAGTGCCAGGATTACAGGTATAAGTCACCACACCCACCTGGAGTCATTCTAACTCC
TATCTTCTCACACCCTATGCCCAATCTATCAACAAATCCCTGTAGTTCTACCTGCAAAAT
AATTCCAGAGTACATCTTATCTCCTCCACTGCCAGTGTCCTAGCCAAAAAACCCTATTGC
CTGATTTTACTGCAATAGCCTCCTAATTGCCCTTCTGGCTTCCTTCTTCCCTGCTCCCCA
CATAGTCTACACATAGCAGCCAGGGCTCTTATTAAAGTCACTAATTAAGGATCACTAATT
GGACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAAGGAAATATCCTTTTAAAGCTCAG
GCAAACTAGTGTTTGTCTTATATCCTGTCAAAGGAAACAAATGGAAATAGAAAAAAAAAT
TAAAGGCCTGGTGTCATGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCTAAGGCAGG
AGGATTGCTTGAGCTCAGGAGCTTGAGCTCAGGAGTTCGAGACCAGCCTGAACAAGAGTG
AGACCCCTGTATCTACTAAAAATAGAAAGAAATTAGCTGGACAACTAAAAATATATAGAA
AAAATGAGCTGGGCATGGTGGCACATGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCA
GGAGGATCCTTTGAGCCCAGGAGTTTGAGGTTACTGTGAGCTAGGCTGACACCACAGCAC
TCCAGCCCGGGCAACAGAGTGAGACTCTGTCTCAAAAAATAAATAAATAGAAGTCAGATC
ATGTCTCACTCCTTTCTCCAAACCTCCCAAATCATTTCCTACCTCACTCTAAATAGCAGC
CAATGGCTTAAAAATAGCCTACAAGGCTCTCCATTATCTAGCCCCACCCCATACCTCTGT
GACCTCACCTACTCAAGCCACATTGATATCCCTGCTGTTCCTTCCTCTGCCAGGAATGCT
TCTCCCTCAAATATCCACAAGGATCACTCCCTCACTTCCTTCGGCTCTCCAGCTCTCGGC
TCTCGGCTCAATGTCACCTTATTAGAAGAAGCTTCTCTGACCACCCCAAATAAAATAGCA
ACCCATACCCTACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved