Microcebus_murinus Locus Mono:145:SNORD116
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:145:SNORD116
Microcebus_murinus
Mono:145:SNORD116
scaffold_84063
SNORD116
1001..1075
1882
TGACTGGTGCATGCGTGTTCTCTGAATGTCAACGTGTGGGGTACAGTGGAAGCTCTCTG
AGCGTTTGGGTGGCAGGAGTGCCTACGATCCCCGTGTCCCTTGCGGTTTGGGCGTCACCG
AACGCCACGGCGGGGCCTCCGTGGTGAACAGGGCCAGCACGTCTTTGTCCCGTGCACGGG
ATGGTTGACGGGGAAGGAGGATCCCGGTAGCGCCCTGGGGTAGTGACCGAACCGTGGTCA
GTTCGTCTGGGCCACTTGGGTGTCTGAGAGTCCTTCGAGGGTTGGAGCGATTCCTAGGTA
GTGCCAGGAATGGCTTGACACGAAGCCTGTGAGGCCTTCGTGACCCGAAGAGCCATCGTG
GGCTTCTGTCTCCCTGACGTGGGGGCCGCTCGTTGAGCTGAGCATCGTGCAACGTCAGAA
ACGCCCGAGAGGGGCGACGAGAAAGCTTAAGAGTGCTTTACGCACGGGAGTCATAGCGAT
CGGAGGATAGGCAGCCTTGTCTTTGGTCGTCGTCCCCCGGCCTCGGGAGACAGCCACTGT
GGCCTGGGCCCCTTACCTTTGCCGATGGGAATTTGGAAAAGGAACACGCGCGGTCCCCGT
ATGCCCACACGTGTGATCTCTTGCCGCAGGACGCAGTGGAGTGAGACCTGGGCTCCTTTC
CGGGGGATGAATTTCTCCTCTCCCCTGTGTGCCGATGTCAGGGAAGCCTACGGGGGAGCA
GTTCCGGCCGCCATCCCCAGAGTCCCGTGGGAATCCCCTCCTACGGTAAGGGTCCTGTCC
CACGGTCACCGCGGTGCCTGGTTGGGGTGGGGATGGGACGGTGACTCCGCGTGGAGGCGG
GGCCCTGACCGTGCTAGCCCGGCACGGGGGCCGGTCATGGCTTGTGACGCCGGTCTCCCT
GGTGGGAGAGGGTGGCTCGGCGAGTCCCAGGGTGACAGAGAGCCGAGTGCTCAGTGTCGG
ACCCGTATCTGGGGCCCCAGGTCCCTTTCGCACGCGTGCCTGGATCGATGATGTCTAAAA
AAAAATGGAAACTTTTGAAATCTGAACAAAATGAGTGAGGACTCGAGCTGAGGTCCAGCA
CGGGGATCGCCACGCTACCAGGGTGGAGGGAGCTCAGTCAGCACAGCTAGGGGTGTGTGG
CAAGGCCTGTGATGTTCGGAGAGCTAAAATGCTCACGCGCTTTGAAGCGAATTGCTTGGG
TGGTGGTGTGTCCAGGCCCAGTTGGTGGCTTGGGGTAGCATGGAAACCCTTTGAGGGCGT
GGCCGGTGGCTTCCTTACCGCCCCCTCCCGAGACCCCGGGGAAGTGAGCGGGAATTGGCG
ATTCCCCCTGGGAAATCAGTGCGCCTTCCCATGAGCCCTTCTCCCACCTGGCCGAGCTGG
CCAGGGGCTCCGATGGGTGGTCGATCTCTGTTTTCTCAGGAGGGCAAATTGAAAGGTATG
GCCCACATGCAGGGACGGGACCCCGCTTTATTTCCTGGTCCCTTTCGCCTACGTGAAAGC
ACTCGCGTGGAGATCGAAGAGCAGACGCCCCCTGTGGAATCTTAGCGATCTTTCTTATCA
AAGACCGGGCTGGCCACCCAGCCAGCCACGGGATACGGCGTGCTCGACCCTTGTGGGTTC
CCTCATCCACCCAGCAAGCCCCTTTGGGAGGCCTTACGGTTGAGCCTACGTGTGATCTCT
GCCGCGGAAGACGCCATGGAAGAGAAGCACTGGGCTCCCTTTCCCGGGGAAGAATTTCCT
CCTTCTCCCCCTTTGTCCCGATTGCCAGGGAAGGCCTACCGGGTAAGCGGTTTCCGGGCC
GCCCATCCTCCAGAAGCCCCGTGGGAAATCCCCCTTCCTTACGGGTAAGGGCCCTGTCCC
CAAGGTCACCGCCGGTCCCTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved