Microcebus_murinus Locus Mono:108:SNORD89
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:108:SNORD89
Microcebus_murinus
Mono:108:SNORD89
scaffold_6357
SNORD89
1001..1112
2112
ATAATGAATACTTGGTGAGTAAACAGTTTTACTAAAAGTCTATGGCCAGATTTAGTATA
AGGAGCTATCGAAATAGAAAATTTGCCTTGCTCTGAGCATTAATTTTAACAAATAGCTTC
AAAGGTTTCAGTAACAGCCATTGTCTTTGAAATCTACCTTCTGTAATTCAGTGTGAATAG
AAAAATACATCCTTGATTCCATACGAAGTAGATTGTTTGCTTTTTGTCTTTTAAGAAACA
TACTCGGGGAAAATGTTTTAAGTAATACTTTTTCCTAGTATTTAATGAAGCTGACATTTA
AGCTTCATTTTAAGAATACTGTGACAGCCTAAGGTAAATTATTTTTGATAGTTACAGAAG
TATGACTTTTTAGCAGCTGTCAGATACAGCTTGATTCAAAAGTTTGAACACAAAATTACT
TATAATAAATTGTAGAGCTTAGATTAATTGTAGTCTTATCTACTACTCAACAAAGTAGTC
TTTAGCAGCAAAAAAAATAAGAGAAAATGTTAGTACTTCAAAAGGAAAATGTTTGATAGT
TTATCTGGATGGAAGTAACATGATAAAGAAGGGTCAAATATTACCAGAATGTTTGCTAAA
CTTTCAAATTAATAAGATGCTAGGAATTTGGGGAGTGTAAATGAAAAGCATAGGAAATCA
GAGAGATTGAGTTATTTATAACAGTAATCACTTTCCTCCTAACAGTTGTCCTAAAAGCCA
TGTGGTTCCCTTATAATGTGGAACAGTATTTAACTTTGAAAACTCAGGTTGCACTGTGAA
AGAGGCAGCGTGCTGGTGACTGCGATGCTGCGTATCGCCTGCTGCCCAGCGTCACTCTCC
AGTGTCCGAGTCAGCGTTCTGGGTTTCCCAGCAGAAAACCAACCACAAAGGGCCAGAGAG
ATGTAAGAACGTGCATTATTTCACAGGTAATAATTTCCCACATCTGTCTTTTTAGGGATG
TTCAACACACAGCCTTTCCCAAAAGATTGCTCCCCACAGCTACTGAGGAATGATGACACT
AAAAGGCCGAATTGCAGTGTGTCCATCAGCAGTTTGCTCTCTGGGCACACGATGACAAAA
TCTCCTGAAGCGAACTAGTGGTCTGACCTCAGTAACATCAAGATTGAAGCTTCATGCCAT
GGGAGTAGCCATGAAAGGCATCCTAAGAGCTGAGTTATTTTTAAGAAAAAATAATCAGCA
ACCCCCTCAGACAACACTGGGGCTTGAACAAGTAGTAAATATACTATGTACATGAAGATA
CACTTACTTGAATTAAGGACTACTAGAATCACAAACATAATAAAAACAGACCTTCGAGAA
TAGGTCTGCGTCCCCATACCATATACTTGGAACAAGATACCCAGTGTAACCAAATTCCCC
AGTAAAATAGTTTGGCAACAGTCTCTTGATAAAGTTCATTTGCTCAGTGAAGGCTGAAAT
TAAGTCAATATGTTTGTATTACCAACTAGAACCTGACATAATTATGTTTTATTCAAAAGA
GTTTCTCAGAGAGTAAAATAGTGGGTGGTTTCCAGGAGCTGGGGGAAGGGGCAGCAAGTA
CAAAGTTCCAGCTATGCAAGATGAATGAGCTCAAGAGATCTTCTGTATGCATAACATTGT
GTCTGTAGTTGACAATACTGTATTGTGCACTTAAAATTTTAAGAGATCGCATATTAAACA
TTCCTACCACAATAAAAAAAAAAAGAATTTTTTTTTTTTGGAGACAGAGTCTCACTTTGT
TGCCCAGGCTAGAGTGAGTGCCGTAGCGTCAGTCTAGCTCACAGCAACCTCAAATTCCTG
GGCTCAAGCAATCCTACTGCCTCAGCCTCCGGCCGAGTAGCTGGGACTATAGGCATGCAC
CACCATGCCCGGCTAATTTTTTGTATGTTTTCAGTTGGTCAATTAATTTCTTTCTATTTT
TAGTAGAGACGGGGTCTCGCTCTTGCTCAGGCTGGTTACGAACTTTGACCTCTAGCAATC
TGCCTGCCTGGGCCTCCCAGAGTGGCTACATGAGCCACCGTTTTTTTTGAGACAGAGTCT
TACTGTTGGCTGGGCTAGAGTGCCCTGCCGTCAGCCTAGCTCACAGCAACCTCAAACTCC
TGGACTTAAGCGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved