Microcebus_murinus Locus Poly:2:SNORD88
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:2:SNORD88
Microcebus_murinus
Poly:2:SNORD88
scaffold_25342
SNORD88, SNORD88
1001..1091, 3317..3406
4406
AAGGCCAGACACCATCATTCATTGGGAAAGCACTAGGTTTTAGTTGCTCCACTATTGGA
ACACTTACTGATATTAAGGAGAAAGTGAGAATGGTGTAACGTGTGACAGGCGGTGCTCCA
GTGAAAGTATCAGTTATTACTAAGCAGAATAGTGGGTTAATTATTGAAATGGAAAGGTTA
TTGATGTGGTTAGGAGATCAGAAAATAAAGGTAACATTCCCATTACCTGTAGGGAAAAGT
TCAAAGCATTTTCAGTGATTTATAAGCTGTGTGTAGAAAGCAGAGGCAGTGTAATGAGGA
ATTTGTTGGAAGGAAAAGTTGGTTTAATCGTTTTTAAAATAGGGCAATGAAAACTTTCTG
CTTCTTGTAAACATAGGGTCTCACTTTTGGTCAGGCTGGTCTCAACCGCCTCACCTCAAG
TGATCCTTCTGTCTTCAGCCTCCCAGAGCACTACAATTGCAGACATGATCCGCTGCCCGG
CCAACTTGAATTTTTAATACTGCCACTTGCCATCTGTTTTGTATTTGTTGTTTCTAAGTC
TTCTCCAAAATGTTTTTTACAACTGATTTGTTCAAACTTGGTTTAGTCGAGGGTCTCTGG
TCATTGCTTATATTGCTTACAGCCTGGCTTTGGTTTTACTCTAGAATAGCCCCCTTCCTC
CTCTCAGTGGGTTCTTCCTGGGGATTTGCATATTGGTAGCTTTCCCTATTCAGGGTTACT
AGCAGGTATAGCTAGTGTTGAGAAAATCTGCAAAACTGGGCAAGGGAGGAGTGGACATTA
GGACTCTCTTCGTGGAGTGGGTTTAGAGGCCTGTCCCATGTGGACAGTCCCCTATGGACC
TGTGACATTGGGGAGGTAGGGACATCCCAGTGTTTACATCAGCAGAACTGCTCATTCATT
ACCTTCCTGGTGGGTTTTGTGTTTCCTGGGTGCTAAGTTCTATAAGCTTGGCTTCTGTCC
CTGAGGGTAAGTGGCCTTGGGACCTTGTTGCACAGCAGGTGGGGCTCCAATGATGTCTAG
CACTGGGCTCCGATCACCCCTGAGGACACAGTGCCCCCCAGGACCTTTGACACCTGGGGG
TCTGAGGGGCCCTGGTTTTGATGTTCTTCTGGACTTGAAGACTGTTTGCTCTCCCCCTAA
CCAAGTTCTTCTGTGTTACAGGTGTATCTTCAAGCTGAGGGGCCACCTTCCACCATCCCC
ATCATAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGATTTGCGTTTGTCCTTTAGATGTCAGGAGTGGTGGAGAACATTGGCTGCAGTGAGAAT
AAGAGTGAAAGTATGTCTGGGTTCATGGAGGTTTTCCTGAAGGCCTGTCTTGGATTTCAG
ATCTTCCAAATATCTTTCCGAGGGAGCTGATCATTAGGTATGGCAGGCTTAGAGGGGATT
TCTGGGGACATGGAGTAGGGACTTGTGAGAGGTGAGGAGAAAATCACTGGGTCAGGACAG
GAAAGATGAAAGGGACCCGTAGCATGTAAGGGTTCTAAGCCATAGAACTGCCAAGTTGCA
AATGTTCCTCCCATTGTCCATTCTGGTGGCCACTGACCACAGAGGGTCTTAAGCACCTTG
AACATGGCTAGTGTGTGTGGGAACTGGGTTTCTAATTTATTTTATTAGTTTAACATTTGA
GGAGCGGTTGCCTCTTTGAACAGCATGGTCCTACACAGTAGATTTGGGTGTTTGTGGTTG
CTAAATAGCATCTGACACTCAGCGAGCAGTTGCTGTGTTGTAGTACTTGGGGGAGAATGA
ACTCAACAAATCCTACCAGGGTCCCAGGGAGCAGCAGCTAACCTTTCCCTGTGCAACAGG
TTCTGGTGAGTTCGCTTCCCAGAGTTAAAGGGCCATGCAGCTTGAAAGTGCTGGGTTGGG
GGAGCCCACCTGAGGTGTGGGCAGAAGCAGTCAAGGAGTGTGCTCATTAGGGTGGGATGT
CTAAGCAGGGGTGAGCCGTGCCCTGTCCTCTCACTGAACTCTGCAGGTGTGCCCTCTGCT
GGTCATTTCTAGTCCCATTTTTCCATAGGGAGAAACAATCTGAGGGCAGCTTAGGTCAGT
TGGTTGCAGATCATATACAAGGAGCAACACCCAGCTTCAGCTGGACAATAAGGGGTGACC
TTAGGGACCTCACATCAGAAAGTAAGCCCTGAGGACTTGCCTCATCACCCACAGGGGCCA
GGTAGAAAGGTTGTTTTTTTTGCCAGGATCTCTGAGTTGTCTACTGCCTTGTCCCCCTAG
GACAGTAAGTGGCACTGGGGCCTCCATGATGTCCAGCACTGGGCTCTGATCCCCACTGAG
GACACTGTGCCCTCTGGGACTTTGACACTTGGCAGTCTGAAAGGCCCCTGCTCTGGGGAG
GGGATGATGGAGGTGCCATGGCTGCCCTGTACCCCACTGAAATCCTTCCCCCATGCCCCC
TGTTTTGTTCCTTCCTGTCTACAGGTGGCTTCTCCAGGCATAGGACATCCACTCCACCAA
TCCCTCTCTAAGATCAACAGGCTGCCTCTTATTAGTGGTGGCAGTAATAATGCTCACAGA
TTAATGCTCACCCTGTGCTCTGAGCCAGGTGCTGTTGTAAGCAACTAGAATTGTTTAACA
TGCTGACTAACACAGTAGAAAAAAACGATTTTTTCCTTGGGGCCACAGTGTTTTATTATG
AAAATAGAATAAAAACTTTGAAAACAAAATGATCCTTACTAATTTAATTATTTAACTAAA
AATTTTATTTTTTATTGTTTTCTGTGTGTGAGTTATATGCAACTCATGCCAATTTTTACA
ATACACACCACATGAGTGTTGCATGTGACTCACGATATACTTCCTGAATTTATTTCTGAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved