Microcebus_murinus Locus Mono:40:SNORD55
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:40:SNORD55
Microcebus_murinus
Mono:40:SNORD55
scaffold_9317
SNORD55
1001..1080
2080
CAATCTATAGATACAATGCAATCCCTACCACAATACCAATGATATTCTTCACAGAAATA
GAGAAAACAATCCTAAAATTCATCTTAAACCACAAAAGACCCAGAATAGCCAAACAATAC
TTATTAAAAAAAAAAAAAAAAGCTAGAGTTATCACACTACCTTGCTTCAAAATGTACTAC
AAGTCTATAATTACCAGCATAAACACAGACATATAGACTAATGGAACCAAACAGAAAATC
CAGTAACAAATTCACATATTTACAGCTAACTAATTTTTGACAAAGGTGCCAAGAACATGC
ATTAAAATAAGAACAGTTTCCTCAATAAATAGTACTGGGTAAACTGGATTTCCATAGGCA
AAAGAATAAAACTAGACCCCTATCTCTCACCATGTACAAAAACCAAATCAAAATGGATTA
CAGACGTAAATCTAAGACTTGAAACTCTGAAGCTACTAGAAAAGAACATTGGGGAAATGC
TCAAGGACATTGTTCTGGGTAAACATTTCATGAGTAATAATTTAAAAGCACAGGCAATCA
AAGCAATACTGGGCAATCAGATCACAACAAGCTAAATACCTTCTGTTCAGCAAAGGAAAC
AATCAACAAAGTGAAGAGAAAACTGACAAAATGGGAGAAAATATTTGCAAACTGCCCATC
TGACAAGGGGTTAATAACTAGAATATATAAGGAGATAGCCTTAGGAATAGTGCAATAATT
GGGGATTTAACAGCAAAGATTTTACCAATCCCAGGTATGAAATTATGAGGGAATAAAGTA
GTGATCAAAGTCCAGAACCCATTGTATACAGGGGGATTCCTTCAAAGGAAGCTTCTGTTT
GTAAGAACGAGGTTTTGCAATTTAGTATCTTTACTTTCTTATTTTGCATGGCAAAGTTTG
ACATAAGAATTCAGATATCATATTACTTATAAAGCTGGATAAATGTGGCTTATCTAGGAA
TAATGACAAGATTCTTGATTTTCAGTACTTAAGATTAGTATTGCGCATGATGACACCTGG
GAAATGCTGCAGACTGCCGAGTGCGCAGTGGGGAAGCCAACCTTGGAGAGCTGAGCGTGC
GGGGAAAAAAAAAAAAAAAAGATTAGTATTTTAATTTCAATTACCTACCTAAGAAATTAT
TTACCAGATAACTAGAAAGGCTTTTATATAACATGACATTTGTTCTCATGAGATCAACTC
CCTGACTGGGAAGATAATATCATGATTTTGTAGAAATACCAGTGGTATGGGACTCAGAAG
AACTACATTTTAGTCATGGTTTAGCTGTTAAAGTTTTATGGCCTTCATTTCTGTCAACTG
AAGGGGTTAAGTAAAAGATATATGAATTGACTAGGACTAGAGAGTCAAAAATTTTTATAG
AAGCTTCTATAGGTTTTGGAGTGTGGTATAATACGTTAGGTTCCTTGTAGAGTGCACCCC
AGAATAAAGATTTGCATGAAAGTAGTTTATTTGAAATGTGATCCTGAAAACACCTATTGA
GGAGGAGAGACATGACATAGGTAAATTAAGGAAGTCAATAAATGGTGTGTTACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved