Microcebus_murinus Locus Mono:31:SNORD87
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:31:SNORD87
Microcebus_murinus
Mono:31:SNORD87
scaffold_29418
SNORD87
1001..1088
2088
CTACTCAAGCTCTGAGACAGAAATGCAATGGCTCTGTATTCATTAGGACCATGTGTCTT
ATAATCAAAGCTGTGATGGTATCATAAAATGTTTACACCATTTTTCCTGCTTGAGAAAAG
CTAATTTATGGAATTATTAGGTGCTAATCAGTCAACGGAATTGTTGACATACTCAAGTTA
TTGTAGATGTTTTGAATTTGGGTTTGTCAGTTACAACTATCAAAAAGTATAAAGGGCTGA
GCATGGTGGCTCATGCCTGTAATCCTAGCACTCTGGGAGGCTGAGGCAGGCGGATCGCTC
AAGGTCAGGAGTTCGAAACTAGCCTGGGCAAGAGCGAGACCCCGTCTCTACTAAAAATAG
AAAGAAGTTAATTGACCAACTAAAAAAATATATATGCAAAAAATTAGCCGGGCATGGTGG
GACATGCCTGTAGTCCCAGCCACTTGGGAGGCTGAGGCAGTAGGATTGCTTGAGCCCAGG
AGTTTGAGGTTGCTGTGAGCTAGGCTGATGCCACGGCACTCACTGTAGACTGGGCAACAA
AGTGAGACTGGCTCAAAAAAAAAAAAGTAATAGAGCAAGAATTATATTCCTTTATTCCAT
TAGAGATGTATTGAACAACAGACTTTTATTAAAAAGTGGGTTCGAGTCTCAAAAGATAGG
TTGCAAGTATGGTGTTTTGTGGTTCCTTAGAGGAATGAAATTCTCTTATTAGACCATTCC
TTCATATAACATGCCAAACAAATGCAAGTACAAATGAGAATTGACAATGAAATATTCAAT
TTCCAGGTGAGAAAAAGCCTATGAGTTTTGAAGGTGTGTGAAGGTCATTGTGACAATGTT
TTCCAAAATCCTATAGAAGATGGCAGTGAAAAAGCTAAGACCACCACTGCATGTATTAAA
GGTACCAAAAGTTGTGTGCTTTTTTTTGTCCTTGTGCTATTGTTACTAAGGGGCAGTACC
CCAAAATGTTTAATGTGCTCTTGATATTGATAAATTTAATACCTGGCACAATGATGACTT
AAATTACTTTTTGCCGTTTACCCATCTGAGGGTGTCTTTGAAGAAATAATTTAAGACTGA
GTTGCCAGTAATCTGTGTTGGTTATGATAATGGCATGTAATACAATTTTTTATTAAGAGG
TTAAATGTTTTTTCTGTTTAGCAGATAGGTAGCTGCAGATGAGTGTACTTCAGCTGTGGT
TTTTGAAAATACTTCTTCATCGCCTCAAGTAAGTAATTGTAACTTGTGAAGCAACTGTAT
CTGCTGACAGTTCAGAAACTCCAAAGGGTTGGGTCTAATTCCTGTTGAAGTTGTCTTTGC
ATGTCAGGGTATGGTTTCCTTTTCTTGGCATTAATTTTTTTTAAGGACACTACGCATATT
GAGGTTATGTGATCACTTTATCTTTGATAATGGAATGTTTCTGATTTTTTTGAAGGTGTG
GTATGCAACATTTGGAAGAAGGAATGAAGACTTCAAGAAAACACATGAACAGAAGCAAGT
GATGCAAATGAATGTTTTACTTGATATTAACATCACAATAAATTATNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved