Microcebus_murinus Locus Mono:216:SNORA57
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:216:SNORA57
Microcebus_murinus
Mono:216:SNORA57
GeneScaffold_1777
SNORA57
1001..1147
2147
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGCAGATTACAGGGA
TAGGACCTGTCATTTCTGCAGAAATGAAACTGAACAGCTAACCTCTATTTAGCGCTAGCT
AAGTGCCCAGCACTTGCTAAGGGCTTCAGAGGCAACCTTTAATCAAGTCAAATAATCAAA
TAATCAAGCCCCTCCCTTTGCAGATAAGGGAACTAAGGCTCGCCCACCCTCCTACTTTCT
GGTTCCCTGCAAAGTGGCAGTACCCCTCCACCACACACCTCCAGGGACAGGCGAGGCTTG
AGCCCTCCTACGCCAGCTTTGAACATCTGCTGTCCGAATTGTCCACCCATTTGCAGAGCT
ACTTCTTAGGACCATGGTCAGTCATTTATTCAGTCAACAAATAGCTTTTGGCTGGTCTGC
TGGTAGTGGGTTATCAGAACTCACTAACATTAGTGTCACTAAAGTTGGTATCAACCCCCC
ACTGCTAAATTTGACTGGCTTTAAAAAAAAATAGCTTTTGAGCACCTGCTATATGCCAAA
ACTGTACCACATTCTAGAGCTACGGTGTTGAACAGGACAAACACATCTGTCTACTTGAGG
CCTATAGTTTTTGTGGGGAAGATAAGAAACAACATCACCTACTCAACAAAGATCAAAGCC
ATTTCAGGGAGCGAAGAGTGCTGTCAAGAACGTGAGACAGCCCTCCTTTTCTTGGCGGGG
GCCGGGTGTGCGGCCCACTCTCCTTTATGGATGGAGGCAGAGGGAAAGGGCTCTGGCACC
TCAGTGTCATGTCTTCAGTGCCAGGGGCTTCCCTTCTTCCGGTTCTAGCCGCAAGAAGCA
GGACACCAGGAGAAAAGAGGGAGAAAAAAGAACATGAAACAAGGTAATGAGCTTAAAAGT
AATCAAGGAAGGAAGCACTTTTCTTAAGAAATGACGTTTGATCAGAGACTGAACAACAGC
AACAACAAAATAGGGCAGACAGAGAGTTTATAGGAGAAAATATAGAAGGACAAGCAAAGG
ATATAGCAGGTACAAAGGCCCCGAGGCGTGGCCTGAGGGCAGGTGAAAGAAGAACCACAG
GAGATAAGTTGGAAAAGGAGGTGAGGACCAGATTAAGAAAGACCCCACAAGTGTTACAGC
TCTTTTAGAATTTGTCTAGCAGGTCTTCCGGTCCTCACCGGAAGGTAAAAAAATTAAAAA
AAAAAAAAAAAAAAAAAAAAAGAAAGACCCCACAGGTCGCAGCAAGACACCTGGGCTCTG
TTCACAGTGCAGTGAGAAGGCAGTGGTGGGTTTTCAGCTGGGGGGTGATGTGACTTATCT
AAACGGTGTGAGGACAGACTGCAGGGGATCAAGGGCAGAGGCCCTTGGGAGGCCCAGCAG
AAGGCACTGGATCCAAACTCTACTTGGTCGCCTGTCAAATATGTGAAGACTGCTGTCGTA
GTCCCTATATAAATCTTTGCTTTCACAGTTAAATCTTCTCAGTCCCTCCAACCCTTCCTT
GTATGGCAGGGTTTTGAGGGTCTGCCCCTCCTGCTCTGGACACACTGGCTTCTTGAAGCT
CCTTGCAACACTGTGCTCCATTTCTACCATTCCTTCTCTTCACCAATCTGCTCCACCCCA
AGCCCCAGTGGTCCATTCTTCTAAGAAATGAGCTTTATTTTCTCATCCCTGCTGATAATA
TTAGAAATGGGCTGATCACTGCCGCAGCAGGACGGGCCAGAGGAGAACACTGAGCCATGA
TACGGTTGTAATAAACAGTTTGGCCACCCATGGGGAGCTCTGAAGCTACGATGACCCTTC
AGAGTTGGCCTGAGTGGGGACACAGAGGCCAAGATGTTATTCGCTATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved