Microcebus_murinus Locus Mono:100:SNORA48
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:100:SNORA48
Microcebus_murinus
Mono:100:SNORA48
scaffold_6940
SNORA48
1001..1130
2130
GGTCATTACACACATTTTGTGTGTGTGTGAGCACGGCTATGGGATAACCTGCCTACCTA
CCTAGGATGGCAATTCTGATCACCTCAGCCCTATAATTTCTTCTTCTACCCTGTGCGTGT
GCAAGTAAACACACAACAAAGGCCAACACAGTTACAAAGGGAATGATTTAAGGTAGATTT
CTCTGCTAAAGACAGAAAGGTGAATTTTTGGTCATAGAAAGGAAAAAGGAAAAAAAAGTC
CAATTTAAATCTCCCATGAAATATCCTGCAACATAACAAATAGATTAAGATCTTGACAAA
TGAAAATGAATGTGCACTCTAAAATATTTAAAGTAGGTGGAGTCTAATCAGAAACCTGCT
CTTTTGCCTTAGTATGAAATGCAGAAGAGAGGCAATGATTTTTTTTTCTTCTACATGAAT
TTGAAATTGATTTGATTCTCTAAGTTAAATAGCTTCCATATCAAAGGAAAGTTAAAATGG
CTGCTTACTTATTTACTGTGAATAGTTAAGTGGTTTGCTTCGTAAATGCTAATTCAGGAA
AAGTAGTCACTTATAGAGTGCAATCTTAGGTTGTATAAACAGTCTGTGCTGCATTTGGTG
TTGGGTGAATTAAGATATGAGTCTACTGGCAACATTTTGCATAAACAATACATGTTAGGC
AAAGATTCAACAAGCTGTACTATTAATCTGTTGCCCAAAATTCCTTAGTTGAAAGTATTC
TTCAAATTATTTTTTTGTGTTTGCTAAATGTTTTGTTAACATGGCAATATTTCTGCTTTA
CTTTCCTCAGAAGGTCTATATTAAAAAAAAACAAAAACAAAAAAAACCACTATGCTCCAC
ATTGTTTCATGAAAAACTGCATTGTCCTCTTTATGGCTAGAGTTAGTCTGCATAATGATA
AAAAATAATACATTTACATGTCTACATTATATATTAGGAAGTAAACTCAATATACATGCT
ACATATTTGTTTTGGTTTTTAAAAAGAAATGACAAAAATTCTGACCCTTACTTGAGCGGC
ATCTAGTAGGTGGTGCCCATCTCACAACAGACAGGGACAAAGCAACCCTTTGTTTATCCC
AGCTTGGCTTTTGGTCTGTGCCCATGCCTGGTTCATGTCTTGGACACATAGGAAAAAATG
ACAAAAATCCTAGAGCTAGATATTTCACTGATTTGGCAGATGGTTAGCTTTGGGGTACCA
TGGATTTTCTTTTCATATGAGGCTGAGTGCTAAGTGTTTGGATGGACTTAACAAGAAAAA
AGAACTCATCTTTTCAATGCACTTACTTTTAAAATATATTCAGTCACCATAATTTTCACA
AAATGCAAGGGGTATCCGCCTCCCACTCCAGTTCCTGATTGCAGTAGAAGACGAGTTCCT
CTAGGGAATAAGCTAGAGATAATTTTATTTTATTAATAAAAATCCAAAGATGATAGGCTA
TTTTAAAAACCAGCACTATGAGAAAAATTTAAATGCTAAAATTAAACTAAGAAGCCAATT
CCAAACATTGAAAACATGCATAGATAACAGGAGAAATGGTTACAGATTAAATAGTAGTGC
TCAAATACAATAGGTTGAGCATAATTAAAATATCAAAATTAAATCTGGAATGATAAGTAG
ATCTAACTCTTTTTCCCCCCTATTAAGTAAGTCAAGAGTGATTATGACTCCTTACATGCA
ATTTGGAAGAAAAACGGCAGTTTTCTGAGTTGGGGTGGTGACCACCACACTCAAGAAATA
AGCAGTCAGAGTCTGCTTTCAAAGATGGAAAGTTCTAGATGGCTGTGAGAGACCTAATTC
GGACCTCTACTGAAACTGACCAACCTTGTTACTAAGCCTCAGAAACGGTCTTCAGAGATT
TTATGACCTCTTTTAATTAAGTTTAAAGCACCACTAAAAATAAAGCTTGTGTCTCCTTTT
TCTTAAATTTACATATCACCAGAATTCCTTCAGGAATTCTTCATGCTGACTTAGATGACT
TATTAGTAGGTAATAACTTGCTTAGAAATTACACTGTGGAACATGACTTTCCCATCTCAA
TGACATCATAATCATCTAACCATTTGAAAAAGCCAGAAAACCTAGTTCTATCTCCTTCTC
CCCCACCTCTAGCATTTAATCAGTCACTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved