Microcebus_murinus Locus Mono:195:SNORD74
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:195:SNORD74
Microcebus_murinus
Mono:195:SNORD74
GeneScaffold_3542
SNORD74
1001..1075
2075
ATGCTTCTGAGTTAAATCTACTTCTAATGTAGTAGAGCAGCAGTCCCCAAACTTTTGGC
ACCAGTGACCAGTTTCATGGGTGGGGTCGGAGGGGGTGGGGGGGAGGTGTGACAGAGCTC
TGCAGCCTGGTCCCTAACAGTCCAGGACCGAGGCCTGGGGGGGTTGGGGACATCAGTAGA
GTGTAACATATTAATAGAATTACTTTTCTTAAAGCAAGTCTGATAGAGGAAAAAGTAATA
TAACTTATGAGAATTATTTGCTACATACAAAAGAAAGCTTCACCACTAATAAAGCAAATT
ACATTAAATTTAAAAATACTTAAATTGTAAGTATTAATTTATTAAACTTTCAGGAGCATA
TCTGCTGTAAACAGTGTCATAAAAGCATGCTATCATGTACATACTGATTAAAGAATATAA
TTTTATCTATAATACATGCTGACAATATTGAAATAAATTTCAATTTTTTTTTTTTTATTT
TTTTCTTTTTTTAACAGCATTGCTATATCCATATAAATTTCAATTTTTAAAAACTAGAAA
GTTGGTCTAGAAAAAGAATCAATAGAAGAGATAAAACTTATTTTCAGTTATTACTCGTCT
ATTACTTTATGATGTTCTACCATGCCTGAGACCCTGTGCTAAGCTCCAGAGAGTATGAGT
GAGTGAGACATCATCTTTGACCTTAAGGAACTTCCAGTTTGGGAAAGACAAGGCAGCAAT
TACAACACAGTGTGGGAAATGCAATAATAATGGCAGCCTGCGTGGAAGGAGCTCAAAGAA
GTCTTCACAGAATATTCTTGACAGAAAGCACAGCCATGCAAGGTTCAGAGTGGGGGCAGG
TTAGGGAGGTGGTGTGATGTACCAGAGAACAAGGATGCAGAAGGGAAAGTCACAGACTAG
ACTGGAGGTAGAGCGAGGGCTGGACGGTGTCTGATTCAGGCATGGTCCAAGGAAGAAATG
AAAGGCACTTTCATTTGGGATTTTTGAAAAGACCTTTAAGTGTAGGCAGCCTTTGATGAA
GCCTGTGTTGGTAAGGACACCTGAGGGTGAAGTGTGGCAGAGTTAAAGGAACCAACAAGG
TGAGGCCACCAGGGACGGGCAACAGCGGGAAGCCATCACCCGCCCTGCCTGGAGGGGTCA
TAGAGAAAGGGGCCTCGCCAGAATCCGCTTGTGTGCCAGGCCCAAGGGAGAGCGGCCACC
CGCTGAGCACTAAGAATACTAGGACAATCTAAGTAAACCTCCTGTACTTGTTATCAGATT
TAAATATTTTTGCACATTTGTAGATATTTATATTTCATTTGAAGTATCAGATGTGAAAGC
TTAATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved