Microcebus_murinus Locus Mono:74:SNORA72
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:74:SNORA72
Microcebus_murinus
Mono:74:SNORA72
scaffold_21513
SNORA72
1001..1129
2129
ATCCTTGTGCCTACCAGAAGTACTCACATCAGGGCCGTGTTTGGAGACAAGTAAGGTCA
CTTTCCTCCAGTCTATTGTTTGGATTTCTACCCACCCCAAAAGTCATTGAAATGCCTGTG
CTCTGTTTTCACAGGACTCTCCTTCCTGAGAGCATGTACAGCCTTGGAAAGGTACCCCTT
CCATTGGAGCCCCTGGCTGGCTATGCTCCCTCAAGCTGACGAATAAATACTTAAATAGAG
CAGATAGTACGTTTAACTTCAACTGAAAGATGAGTAAAATTGTACCACAGATCAGAAGTG
TGTATGACCACAGTAGGGTTTAGTGATGACACATAAGACACATGGCACAGTCGTCTGTGT
CCAGTGCCTGAGCCACCATCGTCAGCAGATCCAATCTCAGTCCTGGGTCTGCCAACTCGC
TGCACGGCCCTGAGAGCACCTCTGGACTTTCCAGGGGATCGCACTTTTTGGAGGTACTTT
CCAGTATTAAAATGCTACGATTCCATCCAACTTAAAAAATTCCATGAATCAGAATGCTTT
CTTTCTGTGAGCTTTTGTAAACTTGCTCTCCCAGCCATGAAAAATTGGGCTCAGTGCTAC
CAAAAGCTGAGCCTACAAAACTTTATGCAAATTCATTGTTATTACTCTAGGAGATACTAG
GCATTCATCATATTCATTTGTTCTGTTACGTGGTTGTCATTTGTGCACTCTACTGTATTT
TATGAGGACTTGGAAAAGGTTTCTCTTAGTGGTAGATGAGCACAATGGACTAATTGGTAG
CTGTTCTTCATCTAAAATGAGATTGCAACAACTTTGAACTGTTTAGTGGGCTTATGAAAG
ACAACCAGTGACACAACCTTTGTTGAGACACAAGTGTGAATGCAATCAGTAAACAGGATT
TCCCTGCACAGCCTCATGATTACTACTGTGCTTATCAGCATGTATGCACCTTTGAAGTAC
TTACTACTTGCTTATTTACATATTTGTTGTATGTCTCTTTCCCTCAAAAAGGGATTTTGA
GTCAATTTATGGAAATATGACAGGCTAAACATTCGCTATATTAAAACCATGCATGTGTCC
CAGACCTAGTTCTTTCCCTAGGTTTGGTTTTGTAAATGCTTGTGATAAGCCAGGTCTGAT
TTATTTATATGATCATTTGTATGATTGTATAATGGCTGTGATCTAGGTTATCTTTGGTCA
ACCTTAAGAAAAATGACAGTACACCTTATGTAATAATAACTTTTGCAAATAATCAGTGCT
AATTTGCAGACTTTTGTCCAAAGGCATAACCAAAGTAGGGAAATTTTCGGATTGCTAATT
ATCATTAAATAAATTGTAAAATGACTGTACTTTTATTTTCTAGTAAACATAAAAAATTTA
TGGAAATATGCTTATACAATAGGTTATAAATAGATGAGGAATTTGAGGTAGAGGGTAAAT
AAAGGTAGGAAAAACTCCATAAATGCATGGATGAGATTCATGGATATCTGTCATGGCGTC
CTGAATAGCTGTCACAGCCAATGCAAGGAAGGAGCTGTGATTAGAAACAGAAGCTAAATC
ATCTGTACATTTAAAACACAAGACTAAACCAGAAGTGTTGAGGTATGAGGAAAGATTCTT
ACCTGGGTGCTGATGAAGGCACTTCCAGGTGAAACACGATCACTATCATTGACACCATTC
TTGCAACGCGTGCACCAGCAAGTTTCTTATGTCCACTTTTTATAATTTTCATCAAGATGC
AACACAACAGGCCAAGCATGGTTGCTCATGCCTATAATCCTAGCAATTTGGGAGGCTGAG
GCAGGAGGATCGCTTGAGGTCAGGTGTTCGAGACCAGTCTGAGCAAGAGCAAGACCCCAT
CTCTACAAAAAATAGAAATAATTAGCTGGGCATAGTGGCACATGCCTATAGTGTCAACTA
CCTGGGAGGCTGAGGTGGGAGGATCACTGGAGCCCAGAAATTCAAGGCTACAGTGAGCTG
TGATCATGCTACTACTGCACCCTAAGCCTGGGCAACAGAGCAAGACCCTATCTCCAAAAA
AAAAAAAAAAAAAGATGACAAAACAGATAATAATTTAGCAGAAGTAATTGTACCAGCAGC
TAAAATAGCACTAAAAAATATGGAGCTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved