Microcebus_murinus Locus Mono:66:SNORA69
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:66:SNORA69
Microcebus_murinus
Mono:66:SNORA69
scaffold_1039
SNORA69
1001..1133
2133
GGAGGGGAAAAAAAAACATTTCTGCTACATTGACAGTTCTGTGCAATATATTAAGATTG
ATCAAGGCTTGCGTGACAAGTTCATGAACATTGGCTTTCTTTCTGAAACTGAAATGATTT
GGAGTCTGAGAGATTGAATTATTTGATACATGAAGGCCTGTGCTGCTGGGTTTTTGTTTT
GTTTTGTTTTGTTTTTTTACAAGGAAAGGGCCTGTCTAGGTTTTTATCTGTTTGTTAGTG
AGTATGAGCAAGGTCCCCTTCCCTCCACATTTATGCCTCTTATGTATTGCCTATAATGAA
GCCATTCTTTCCAGAGCCAAATTCAATATGTATGTGAGTTCTATCTGTTAAGAACAAAAT
GAGAGCTAGTGAAATGCAAATTTGGTCCTTTCCCGCATACACATAACATACATGTACATT
CACATGATAAATCTCAACAGTAGGTTGGTTTAGAATTCTTCTTGTGTATTCCCTCTAGAT
AACTATCACTGACACACACATACAACAGATATGGACTCTAGGACTGTAGTTATATTTTCA
TACCCAAAGTCACCCCAATCAGATGTACACCCACTACTCAGGAGGGCTGATCTCTCATGT
TGAGCATTGAGCAATCATTTAACCTCTCTGAAAAGTGGCAACGAATATTAATTCCATTCT
CTGTCTTATAAGATTTTGGGAAGATCACTGCAATTAATTTTCTCGATTTTTAAACTTTTA
AATATATGTGTTGAGATATACTATATGACAGGCACCATGCGGATTATTGTGGGCTAATAA
GATAAATAGCTTTGCCCTTGAGGAGCTCTCAGCCTAGAAGACAAGGTACTATCACTACAT
AGTACAATGAAATTATTTGGAAAACACATTCCATAATGAAGATACAGATTAAATACTATA
TAGGTTGTGAAATAAAATTAGTACTTTTGAACATAATGGGTCTGTGAAAGGGAGCGACAG
AGATTGTACAAGTAAAACCTTTTTAGAAAGGAAAAGACATTTACGCAGGTTGTAATTACA
GTGCTTTGTTTTGGGGAAGTACTGCTGTTATCCTGCTGAAAGACAAGCTGTGTTAGTCAT
TTTTGATTTTGCCTTTATGAGGGTAAAAATCATGACAGATTGGCATGGACAATTCTGAAA
AAAAAAAGGGGGAAAAGGCACTTAATGATCTTGTGATTTCTATCCTTCCTTCAGTGATAG
CCAAGTGCACCCCTCAGGGTCAACTATTGGCATGCTTGTATCTTGTGCTATTTTCTTGGA
TGGAAAACCTACTTAAACAAATAATAAAAGAACTTGATTAACCTCCTGACTGACTGATTA
CCCCTTAATTTTAAACCATGCCCTGATAGAATGGAACATTAAATGAATGTTTTGATAGGA
GTGGGAATGTAGGAAAACTCCAAAATAGAGAAATGCCTAGACCCTAAATAGAGGAAACTT
CAAGTAGTGAAGAAGGGAGGGTGAATATAATGAGTACATATGTCAAAGTCTGTAGATGAA
GAATAGAATTTAAAAAAACAACAACAAATTTTATGAACCTCACAGATTTTTCAAGCTCAT
GACTGTAGTGTAGGAAAGAATTTACCAGATATTATCCTTCCCCCTTCCCAAGTTGAAAAA
TTAAACATGTAGTATTTTTTTTCATGATGGTTTTAAGAAGATGCAAGCATGAAGGCGTCT
TGGTATCCTTACCTGGGTTGCTCAAACATCAAACAGATTGTTTTTATTTATAGGGTTAAG
AAAACATTTATGAAAGCTGAATGCATTTGTAATTTGTTCTGATGACTCTTGATCTGTGGG
TCATATTCTGAATTATCACACCATATATTTTTATTTTTCTGAGGTGAAACAAAACCCCTG
TAGTTGCCTCTTCTGTACCTGAAGGCATTTTATCTTCTGGTGTTCCCTTAGGGAGATTAT
TTGACAAAGATAAATCCAGACTCTAAGACTCAGAGCCTTCTGTGAAGGTCTTAGGAAGGT
TTAACCTGGAAAATAGAAGCTTTATGTAGATATTTAAAGGATGTGTAAAACATTAGGCTT
ATTCTATATGGACCACAAGAGCAAAACCAGAGTTGGTGGGTAGAGTTTCTAGTGAGATAG
ATTGTGGTTCCTTGAATGGGAGAATTGCCTAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved