Microcebus_murinus Locus Mono:0:SNORD70
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:0:SNORD70
Microcebus_murinus
Mono:0:SNORD70
scaffold_4679
SNORD70
1001..1089
2089
GGTGCTAGAGGCAAGTCAGAAGCCACCACTGGCCTCTTAAAAAAGGAAACGATGAGAGA
AACTATAAAGTTGTCAGCCAGTGAATTTCTCTCCCATATGAAAAAACAATGGTGAAATGT
ATGATAAAAAGTTAATCGAGTATATTAACAAAAATCATTGATTTTATTGAAGAGAAATAT
CAGAAATAATATGTTAAATTGATATAGACATTAAACATTTTTTTGAAAGGTTCTCACACT
TGAGGTAAGATGCAACATACTCTTTTTTTCATATAGAATGCAAGGGCTTAGAAACATGAA
ACCAAGACTTCATAAATGAGCAACTTTTTTCTAGACAAAGAAATAGAAGAATTGGGTTTC
TTACAAATGAGTGTGAAAACAAGCCACTTTTCATTTTTTTCTTTTTTTTTTGGAGACAGA
GTCTCACTCTTGTTGTCCCAGGCTAGAGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTATATTCCACTTTTGG
AAATTTACAATGCCTATTATTAGATATTAGTTAATAAAGGGTTATGAGAAGGTGTGCAGT
AATTTAGTCTAACTCAGTGAGTTTTTGTAAGTTTCAAAATGTCCACCTTCATTCCATAAA
ACACTTAACCAGATGCCATTTACATCAGAGGAAGAGATTGCCCATGAAACTGACCCACGG
TAAAACATTTGCTATTAACGTGGTCTGATTTTATACATTTTGCACTTAGACAAGTGTATC
ATCATGCAGAAATATAGGTATCACCACTACATTTTACATAAAACGAAGGGAAACTATCAA
TAAACTTGAGAAAGTAGTAATTTCACCTGTCCCTTAAAATAGACATGCCTGTCAATGACG
TATTCTTTTTGGAACTGAATCTAAGTGATCCAACTCAAATATTCATTACCAACACTGAGA
GAGCAATGAAAAATAAAAAAAATAAATAAAAAATAAATATGGGCACACAGTTGTTATAAA
GACATACATAGTAAATGGTTTCTCATATGTAATTTTATTTTATGTTATTCTGCTGTTACA
TAGAGCATAACATTTTCTCAAGCCTTTTTTTTGACTCTAGTCAATGATTAGCAACATGCA
ATGGTGGCCCATGTTCCCCAAAAGCCATCACTAGACAAATTGGATACCCTCTCATCTGTG
CACAAAGATGCACAGAAAAGTACTCACGTTTTAGACTTGGGCTTGTGTATTTTAATTCGT
TTTCCATTTCTAGTATATTAGGAAATGATAATGCACTTTTAGTCTGCCAAAAAGCAATGC
TTGTATTTCTGGCAGTGACACATTACTGCTATTCCGTAGTAAAGCGGATACCAGAGCTAC
AAAGGCAGGAGGTAAGCTGTTAACTTAAACAGTAGCAAATAAAGAGTGAATTAGAAAACT
CAGCTGTTGTCGCAGATATCCGTGACCTCCATAACGTACATCATATAGGAGGCATTTCAA
TTTGTGATCTCTAACCTAGAAATGTCAATGGTTTCCTAGTCGTCCTAATGCCTCTGGTTT
CCTACTACAAAGGAATACATTAAGATCACGGAAGAGTTGCTTACTGAAAGGAAACCCCTG
AAAAAGAGTAAGGGAGGGAATGTAGAAATTCATAAATTACGTAGAATACTCTGTAATTAA
CTGTATTTCTGTATCTTTAAAGTAATACAAAACACGGTCACTTGTAGAACTGGTTCAGAT
TACTTACATGCCAAATACATTTTTAGTCTTCTGTGTGTTTGGAAGTTACTTATGTTTATA
TGAAATGAAGCTGTTAATACCTTTTGCAGCAGTGACTGCAAACCAGAAAGCTAAGACAAA
CACAAATCCAGAAACAGAGTTTACCAAGCTGCAGTGTGAAAAGACTATAAACAGTAGATT
CCATGCCCATGAATAGGTATCTTCACTCTAGAAAACCCAAAGGGAGGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved