Microcebus_murinus Locus Mono:274:SNORA42
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:274:SNORA42
Microcebus_murinus
Mono:274:SNORA42
GeneScaffold_3798
SNORA42
1001..1136
2136
AGTATTAATCAAGAAAAGCAAAGGAAAGGATCTCTTAAAAAATGTATTATTATTTTTAA
GAATTTCTTCCTAGAGATATTGTATACTTAGATACAGCCCCAATAAAGCAGCATNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCATCCCACCCCCAAACATTTAAAACCTTTTCAGATTCTAACAGGGGGAGG
GGTGGGTTGTATACTGTATCTTGGATGGCGGCAAGCAAAGAGTTTTTATTGTTTTTTGTT
TTTAATGGAGATTTGAAATAGGGAAGAGATCCCGTCCCAGCAGCTTTAGAGCTTATCAGT
ATCTTTCGGGTCTTTCTTAGTGCCCTAGTATTTCTGAGTATGAAGAATATGACGCATTTT
AAAAGGAGGCTAGAAAAAAACAGAAAGGATGTTTATGTCATGCATGAGTTTGGATTTATG
ACAGGCCTGTTCTCCTGGGCCTCTTGTGGTGCCCCCTGACAGAGCAAACCATGGCCCTGA
ACCATGGCCTGGCCTCTGTGCCTGTAGGCCACTGGCACTGAAGTGGGTTGCATGGTGGAA
AAGAAAAAAAAAGGAAGAATATGTGTAGGCCAGGAGCGGTGGCTCATGCCTGTAATCCTA
GCATTTAGGGAGCCCGAGGTGGGAGAATTGCTTGAGGCCAGGAGGAGTTCGACCCCAGCC
TGAGCAAGAGTGAGATCCTGTCTCTAGAAAAAAATAGAAAAAAATTAGCTGGAGTGAGAC
CTTGTCTCTAAGAAAAATAGAAAATAATTAGCCGGGTGTGGTGGCTCACTGCTGTAGTCC
CAGCTACTCAGGAGGCTGAGGCGGGAGGATCACTTGAGTCCAGGAGTTGGAGGTTTCAGT
GAGTTGTGACGATGCCACTGCACTACAGCCTGGGTAACAGAGTGAGACTCTGTCTCCAAA
ACAAAACAAAACAAAACAAAACAAAACAAAACAAAACCCCCCCAAAACCCAATATATGTT
GGTGTAAATCCTCCACAGGTTTCTTATATTTTGATATTCATTCCAGAGATGTGGTAAGAA
GTCCATGAAATCTCTTTATTTAGATATTGGTAGGCAGAGATTTGAGACCAGGTCGGGACT
GAGGATTCTAGTAACACAACTTCTTTATTTACAGATAAGTGAGGGAACAGGGAAGGCAGG
GTGGGTAGGAATTTACCTGCTATGGGGTGGGAAAGTGGGGAGAAAGAACTTAAAGTGAAA
CGAACAGCCTGAGAATGAAATGGGAGCCTTTACTTGCAGAAGTTAACGCTTACCAAGTCT
CTTTGACTCTTACTGTCACCCATTTCTAGAGGTTCTTTCCTCCAAATAAAAAATTATCGA
AACTTTGTTCCTCAAAATGGTTTTGGGGTGACGTGACCATCCCACTCTCTTTAAAATGAA
GTGGTTTAGTTTCAGGGGCATGAAAAAAAGTGAAGAATTTTCTGCTTTTGTGGAGAGGTT
GGAGTCATTCCAGAAGCCTACAGCATTCACTGGAGCAGCAAATTTCCTGAGGAAATCATA
TATTTTCACCATTTTTTTCCCATTCTGTCACCCTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved