Microcebus_murinus Locus Mono:270:SNORA42
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:270:SNORA42
Microcebus_murinus
Mono:270:SNORA42
GeneScaffold_2040
SNORA42
1001..1118
2118
AGTGTCTGTGTCCACAAGCATATTATTAAATAAAAGGAAAGCTTTTCCATGTCATATGG
TACTTCGGTTTGCCACCTTGCCCATAGAGGGCACTCAGTCATGCATTCGACACACGTTTA
TAGAACACCTGCTCCGCGCCAGCCACTGCACTAGGGGACGAGCTACAGCATGATCCCTAT
TATGGGTTAAGACACACCCTCTACTGCCCACACTTATCTCACCCTAAGCAGATTTCTAGA
CCTTTCTCTTAATCTCTAACACAGAACCTATCTCTTCTAAACCAAACACACTGCTCTCTA
CCTTTCATTCCATTAATTGTCAGATTAAAAATTACTAAACACAGCCTAAAACTTGTTTCC
ATATGAAGTAAGGCCCTACTTCCAATCCCAGTTAATCTGTTACATATGTAAACAAACAAC
ACAAAAAAATCACTGTACCTCATCCAAATGAAGCTAGTTCCACAGTGCTAAATTATTTGC
AATTTGGAAGGATCAAACATTTAACATACAGTAAAAAAAATACTTGATAAGGATTCAACA
ATAACAAAGTAAAAAATTAATAGGAAAGAGTGTCTCCATTCAGAGACATCTGTGAACAAC
TGAAAGAGATACTTAGGAGAAAGTTTTTTTACTTCAACTTTTTACTATCCTTCTATTAGT
AAGAAACATTTAAAAAGTTAATTTTATAAAAACTCCCAATTTTATGTGCCTGTTGAAACA
GAATACAGTTTGTTTTTCCATATTTAATGAAGTGATAAGCTGCTTCAACCTTAAGCATAA
AATGAATTATTAACCAAAGTAAGCTTTAGGTGTTTTTGTCCTGTGCCAAATTTCTCTACT
CTCCAGCTCCTAACTTTCTACAAAGGAAACATGAAAAAGAACTTTGAAATGCATTGCAAA
ATATGTAAACACCTACCTTTAGTGTCATTGTGCCCTGCAGCTTAAATCCAGCATTACTAC
CTACCAAAAAAAGATCTGGTTGTTTTTTTCCTCCTAACCAGGCATATTAGAATATAAAAC
ACTATCTCATAGTGTCCCATGCCAGAGCAAACTGTGTCCCCGAACCATTGCCTGGCCTGT
GCCCGTTAGGCTGCTGGCACTGAAGTTGGCTGCATGGTGGAAAAATTTAAAAACCAAAAA
ACAAACAAAGGGATATAACATTAAATCCACCATCACAGGACAATTTAAATGGTGTCAAAG
AGAAAGAGTTTAAATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNATCTCAAGGGCCACCAAGATGGTCTCTGAAAAAATACAATAAGTTTGTCACCA
ATCTATGAAATATTGTGTGTATAAACTTAAAAACATATCGAAATCAAAATTTTGAAAATA
TGAAATTAGTAACAAATCTCATTCCTGCTGAATTTAGAGCATAATTCAGTAAGCAGACTT
TTAGGAGTACTTCAGATTTAAATAAACACAAAATAAATATTTTTTTAACTTCAAAGCTCT
ATAGAATAGATCTCATTTGGAATGCTTTAAGAATCTCATATATTCTAAATGTATTATAAC
TTATTTGAAATCCTGGCACTTAGATTTAAGAAAAATTTTCTCACCTGTGAGGGGAGCTGA
TTACTAGTCTGTAATGTTGATGATTTTGCCTAGAAATATAAATGAAAGTGATTTAGCCTT
GACAAAATGAAAAAAAAAAAAAACCAGTAATTTTTTTATTTCCTATCTTGCTTTTTAAAA
AAATACAGAAATATTAGTCTATTTTCTATTTTTCTGCTAACTATGCTTTGATTATCCTAA
AACTCATACTAATCAAAGGACAAGTTCCCTCAAATTGTGAGCCAAACAAATACCTTGGAT
GCTTTATATCTTATCGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved