Microcebus_murinus Locus Mono:304:SNORD23
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:304:SNORD23
Microcebus_murinus
Mono:304:SNORD23
GeneScaffold_2249
SNORD23
1001..1109
2109
GCATTTTTTCTAGCAGCTTGTCTAGGTCATCGCCTATTACAAAATAAAGTGGAAGTAAG
GTTACAAGGAAGGATATGTTTGTATTGTTTTTATCAGTGTCCAAGTCCGGTGGTTAGGCT
GGATTCTCATCAAGATCTGTTGGTTGGCCAGTGATCACGTCGGTGTTTAAGCTTGGCCAT
CTCTACAGGGGCGTCTCTATCGCAAGAGCTACCCCCACTGGTATTGTGCTTACAGTTTAC
ATGCTTTTGCACGCTGCTCTCGCTCTTGTCCTCTGCAATATTCAAAAGCAAGCAGAATGG
CATTACTATCCCCCCATTTGACATATTAGAAAACTGAGATCCAGGGAGACAGAGACCAGC
CCAAGGTCATTCAATAAAGGCATAGCTGAGCTGAGGCTTCTGATCCTAGTACCGAGGTGT
CTTCCTCTAGACCCCCTGCTGCTTCCTGTGGTGTTAGTAACAAAATACTCAGGATAAACC
TCTCCAGATGATATATGTGTGGGCAAGCTTATGCTCCACATTCCTCTCCTCGACAGGCTA
AGATTAAATTCAGAAATCATGCAGCTAGGGGCTGGCAGTGTGCTGGATCTTACAACCACT
CACCTAATGACGTGGTTTTGAAATGTGATGCCAGGAAACTGACCTTTCCTGTGATGAGCT
CATAACTAATTTCTTTCAAAAACTCACTTGTGGTGAGCATGCTCTCTGCCAGCGCTCGGG
ACTGATGCTGGCCTGCAGAACAGAGGGGAGAAGAGATGACTCCGCAATAGAACAAACGCT
CACTGGAACATTATTTGTAATAGCAACAACTGGAAACAACCGAAGTGTGTTACCACAGGG
ACTTGGGTTAAGACAATCAGGGCACATTAAAAGATTTGGAATGTCAATCTGAAGACTGTA
CTGTAGACAGAAGCAGAAAACATTTATAATATAATGCTAGGTGATGAAAGGGAACAATGA
TGTACCTTATGTTTGTAACTGTGAGAACATACACATGCATGTGTTTAACGACTAGGGAAG
ATTCTCGTGTCCCCCAGAGGCTGTGGGTGACACCATGGCTGCCCCCAGTCTGGACCATTT
GGGCCAGTGAGTGCCCAGGGGCTGTGGACATAAGCAGAAAACAAGACTAGCGAAGAATAT
GAAAAAACCTTATAAAAATTGTGTATGCATGGTTATTATGAATATTTGCCTTAAAAATAT
AAACTTATGTTAAGTTGCTTTTACAAATAAAAATTTTAAAAATTAATGTATCACATTGTC
TGATGAAGCTTTCTGAAAATATATATAGCACAGAAAGATGGGTAGACAGGTTTTGTCAAA
GTGAAGGGGCTTCGCCTCTTTGCCAGGAAGAGGTGAGAGCCATTCGGTACGGAGAGGAGA
GAAATGAAATTTAGTCCAAATAGCTATTTGAGATGGTGACTGATAAAAAAACCAAAACAG
CACAGTGAAAAACAAACAGACAAGACAAAAAGACAACTTGCCAACTTTCCGAATCTTTTC
TTTAGCGTCAACATTACAATATTAAATAGACTCTTCAGTGAGAAGAACATATGAGCTAAG
TTTCTGGCAAATTTGACTAAGTGGCTTAGGCCACTTGTGGTGCTGGCTTTATCACATGCT
AGAGTGGTAACATTTGCAGGACCTTTTAAGGACAGCAGTTACATGAGACAAGGGTATCTG
TAACCACGGTGAGCTTTGAAATAATGCTCCCACAACCAGCTGACAGGGGCACCAGCCAAA
CTGAGGGCTACAAAAACCTGACCTGAGGAGGAAAGGAAAAGTTAAAATTAGGAGAAGGAG
CTCGAATTGGAGCAATTCATCAGAGATTGATGGCATGGATGCCCAAAGCACCCAATAGAT
ACTTTTCAAACGGACAGATGATTGAATGAATGGATTCAATAAATAATAAAAAAACAAACA
AACAAGATTACTCACCTAACACTACCACACAAAATTCATTTCCTCTGATTTTTGATGCAC
AAATTGCCACAACATAATCTGGTAGCCTTTGATAGTGTCTCATTTCACTGAGAGTCCTCA
GTGTCTCTGAAATGCCCTCTGCCAAAGAGTTCTGGGTCACGATCACATGAACCAAGTCTT
GAGATACGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved