Microcebus_murinus Locus Mono:121:SNORA73
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:121:SNORA73
Microcebus_murinus
Mono:121:SNORA73
scaffold_18012
SNORA73
1001..1190
2190
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCCACAATTCCAAAATTCCAAAAGCATGTGGTTCTGTATTTGATTATGAGGGTTG
CCTTAGATTCTGCTGAAGATGTTAAGCTATATATGATATGTTTAACTTGTTTATCTTGAA
AATCCTCAAAGTCTTTGTATTCTAAAACTCATCTGTCTGCCCCGTGACGTACAGTCCCTT
TCCACAACGTTGGAGATAAAGCTGGGCTTTGTGTCTGCGCCTGCATATTCCTACGACTTC
TCAGAGTCCTGTGGACAATGACTGGGGAGACAAACCATGCAGGAGACAGCTGTCTAGAGA
AAAAAAAAAAAACAAAAAAACCACAAAAAACTCATCTGGTGCTGATTTTGGGATATGGAA
CTATGGACTTGAATTACTACCCATATTTTACCTATGAGGAAGCCGAGCTGTCTCAAAGGG
ACAGACTTCCCCGCTCCCTGCCCAACAGCGATCTTAGGCAGAGTGGGGGTGATGAACTGT
AGGCCGGTGGTAGGGAAGGTTCCAAGTGGGGCGAACTTCTGTTCTCCTGCCTCTCTCCCT
TCTTGTTTAACACAGCCTGTGGAGACCAAGGTGCCTGTAGTTTAGGCATCCCTGGGATAC
TTCATCTCCTAGTCTTTCCAACCATTTAACTTCTAGCAGGAATGGCTTGCATCTGCAGGT
GTGGGTGCCTCCCAGGAATTTTGCATATATGTAAAGAAAAAGGGTTACAAACAGAGATTA
AATAAATAAAGAGAAAAACAAAGTTTTATGGTAGGATAAACATTTGAAAATGACTATTGT
TCCTAAATTATTTTCTAGGTTTAATGCAATTCAGATCAAAATTCCAAAAAAAATTAACAC
TGTTTAACTTCATTAATAACCAAGGAAATGAAGATTATAAGTTTGCTTTTTTTTTTTTTT
TTTTTTTTTAGATTTCAAATTGACCAAAAAGTGATAAATCATAGTTTATACTAGTGGTCT
CTGTTCATTCTAATCCCACTTTCTCCTTTCTTTCTTCTAATGTTGGGAGCAAAATACTCA
AATTCCCAGCTTTCCTTATAGCAAGGGATGGCCATGTAACAAGTTTTAGTGAGCAGAAGC
TTAATTCCTCTTTGCCTTTTACTCTCTCATATTCTTTCTCCCTGAAATATAGACGTGAAG
CCTGAGAGACAGTAGCTATCCTATGATCATGAGGCTGGAAATGACAAAGGGATGGTGAAG
GAGGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved