Microcebus_murinus Locus Mono:44:SNORA63
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:44:SNORA63
Microcebus_murinus
Mono:44:SNORA63
scaffold_84830
SNORA63
1001..1131
1452
TAGCTAGGCTGATGCCACGGCACTCTAGCCCAGGCAATAGAGTGAGACTCTGTCTCAAA
AAAAAAAAAAAAAAAAAAAGAAAAGAAAAGAAAATCATAAGGAAGAGGAAATATGTTTAT
TATTCATTAAGTGGAAATGGATCATCATAAAGGTCTTTATCCTCATTATCTTTATGTTGA
GTAGGCTGAGAAGGAAGGAGAGGAGGGGGTGGTCTTGCTGTCTCAGGGGTGGCAGAGGCA
GAAGAAAATCCACTTATATATAAGTGGACGTGGGCAGTTCAAACCCTTTTTGTTCAAAGG
TCAACTGTATTTCCTTAAATTGATGCAGGATCTAGTTACAATGTAGCTGTGAAGTGCAGC
ATTGTCTTTGCCCCCTGCTCAAAATAAAACTGTTACCTTTCAAGCCCTGTCTGCCCTAGC
GCTCTAGCAGCAGGGATGCTTGGTCTCATACATGTTTACCAACTTAAGCACTGACTTGAG
AAATGACTCCTGAGAATTAGGGTTTGTTAATATTTTGCAGGTAGTAACAGAAGGGGAAAA
ATGTGATCAGGAGGGAATTCAGATAAAGGACAAACCTATTTGTGATTGCTACTGACTCAC
TTGTAAGTATTTCACTTCTTTCTTTAATTATAATATCTATCTACCAAAAGCTGGTTTAGG
GAAAGGTTTATAGTAGTCTTTGCCAGCTCAAGTTGTGGGGAAGTAAAGACTACACTCCAC
AGTGAACCGTGCCATTATATATAGTTCATTACTGCTTTGTGACCTAGAAGAGTGTGTAGC
AGCTGCTTTTTAAATCAGAATTTTAATTTATACTATCATATCTCAGGTTCTTAATTCTTA
CATTCAAGTAATATATATGGTCATAAACTACAATCTGCCTACTACTTGTGAAAACTACAT
TCTCAAATTGAATATTTGTCATCTTCTTTGAATTCCTTGCTTTTATTCTGGTGAAATAAA
CTCACGTAACATTATATGTCACTTAACCATGGGAATATGTTCTGAGAAATGCATCTTCAG
CTGATTTTGTTGTTGTACAAACTTTAGAGTGTATTTACACAAATATAGATGGTATAACCT
ACTACATACACCTAGGCTATATAGTATAGCCTATTGTTCCTAGGCTACACACCTGTATGC
ATGTTACTGTACAGAATACTATAGGCAGTTGTAACACAGTGGTATGTATTTGTGTATCTA
AACATAGAAAAGTTATAGTAAAATATGGTATAAGTGATAGAAAATAGTACACCTGTACAG
GGCACTTACCATGAATGGAGTTTATAGGACTGGAAATTTCTCTGAGTGAGTCAGTGAGTG
GTGAGTGAATATGAAGGCCTAGGACATTATACTACTGTAGACTTTATAAACACTGTACCC
TTAAGCTACACTAAAAAAAAAGTAATTTCACTATGACTTTATGATGGCAATGATGTCACT
AGGCAACGAGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved