Microcebus_murinus Locus Mono:223:SNORA68
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:223:SNORA68
Microcebus_murinus
Mono:223:SNORA68
GeneScaffold_546
SNORA68
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATTAAGAAAGACCCCCTTCTTGGAGACACTTTACTGCTAGAAATTTGTCAT
TAAAACTATCCAAATATGCTACAAGCAGGGGGTGAGTGACAACTTCTGGGGTTGTGCAAT
GAATGGCCATAAGTGGCCATTACTTAACTTAGTAGCTCATCAATTGAGCTATATCCAATC
AGCATTTGTCCTTCCAGGTAGGCATGATAATGGTACACAGACCTCGGAGTCTGACAAACC
TGAGTTCAAATCCTGGTTAGCCACACTAATCTTTAGGCCTCCATGTCTCTGAAACAAAGC
TCATAAAAATTCATCTCTTTAAACAGAGGTGCAAACAGCAAGTGGATCTCATCGCCTTTG
GGAAGCTGTGGCTGTGCCCCTCAAAGTGAATTTGGAGGTTCCTCGTGGAAAAAAAAATTC
ATCTCCACAGGGTTGCTTTTAGGATTAAATGAGATTTTAAATACCAAGCACTTACCAACT
CATAACAAATGTTCAGTACAGAAAAACTATTACTATTACAGTAATGCTTCTAAAATTTAA
TACATTTCTGAAAGTTCTATTTTGGAATTATCTTCAAAGCCCTTTTACAAGCCATGTGCA
AAAATCATGGATTTCTTTTTCTATTTCTTTGTGTTCCTTGTTTTTTGCTAAAATGATATC
ATATTTGAATCTCCATTATATTAATCAGATATAGCTACAAATGATATTTAGACGTTTACA
AAAGTCAAATCCATTGTTTAAAAAAAAGATCTGCAACCACTGACTATATGTTTCAGTTAC
TTAGGGAATTCCAAAGGCACTGTTCAAAAACTAAATTTTGTATAAAAAGCATTTACATCT
TTTACAAATATCCCAGACATTCTCCACAATATCTAGCAAAAAGTTAGACACATTATTCCC
TGCTTAACTCAAACCATTAAAGACTACTGAATATGAGGTCTACCTAGGGATGACAGTTGC
AAAAATCAGGTCTTAGTTGCCCATAGCACAAACTCGAAGAAACCCAAGACTTTGGAAGCA
ACCCAAGCTGGAAGCTCAGTTAGGCTGACATTCTGGATAGCTCCAGGGGACTTCAGGGCA
GTAATAATCTCTGGGCTCCCTTCAGGACCTGAGAATAACTTTAATTATTACTTCATATTC
CAATTTTCCAGTGCTTAGCCAGAGAATGTCCTTCAGAGGTCACTAGATTCACTAATAAAT
GCTGCCAACTCTGCTTTTTCAGATTATTATTCGTTCAATCAACAAGCGCTTTCTGGCCCT
TCTCACATAAAGAACGCTTGAGGCTGCAGGAGTTACAAAGAAGCGAACACAGTGACCCCT
GACCTCACGGGGTTTCCAGTCTAGCGGAGACTAGAATCTAGAATTGCAATCTAAAGTCTG
TCGATTGTAATCAGTATAAAAGACAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved