Microcebus_murinus Locus Mono:207:SNORA13
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:207:SNORA13
Microcebus_murinus
Mono:207:SNORA13
GeneScaffold_3873
SNORA13
1001..1115
2115
TCATAGGGATTAAATCATATCATAAATCATAAAGCATATCAGGATTAAATAATTAAATG
CTTAGAATAGTGGATACTTTATAATGATCAATAAATGTTAGATATTATTTTCAGTGGTGT
CTTCATAAAGCTTAATGACCAGGTTCAACCTTAAAAAGTTCACATATTTTTCACATTTGC
CTTAAAAAGCACATGGGGTCCCCTTGGAAGCTAGGGAGGAGAAGGTAGCCATCCTCATGC
CCTATTTTAAGGCTGCAGTGGGGCTATCCTTTTGGGGGATCCAAAAATAATAGGGAACCC
TCCAAAGCCGTCTCCAGGGTTGAGAGATTTTGCCCATCTGCTTGCAGCAACTGCCAAGTC
AACACAAAGAGCTTTGTCTCCCATTGAGAAGAAATAGTAGTGGTAAGAACAAGGCTGTAT
AATGGAATCCTAACAATTCTAAAAAAAGCTAACAATAAAAAATGTAAGCTATCGTCAAGA
TTTACCATAATAAGAGCACACTCAGGGCTTTTTCTAAGCCAGAGATAGCTGGGGTGAATT
GGCAGTCGACACTAAAAGGCACATCCTTTACCTGGCTAAGTAAAAGCATGACCATGGATG
CCGTACTGTGTGAACATCCTAGGTCAGTGAACAGAGAGCTCAGCAAGCAAACTGTTCCTA
TGGATCAGGAAACTAAAGCTCAGAGTACTCAAGCAACTTGTCCAGGGTCACACGGTAAGT
CAGCCCAGACTCCAAGCTCCTATGCCTGAGCACTTTTCTTTGAGCCACCTTCAAAGGAAG
CGGTCTCTCTGCTAAAATACTTCCTATATGAGGCATAGAGCCTGTTTGGATTCAAAATCC
ATTTAGGATTTGAGGTTTAAAATTCTTAGGGATTTTATGTATTACAGACATTTAAGGATC
CCCTGTAAACATCACTCTCCCTCCTTTGAAAGGCTAGGTCTTTCCCGAGGTCAGAGGGGA
AGAAAAGGAAGCTCCGCCAAGGGATCAAGGGATCGCAAGGAAGAAAAAAAAAAGAAATAA
AGAAAGAAAGGCTAGGTCCTTAAATTAAATGCTTTGCAGCCTTTTCCTGCCCTTAAATTT
GGTATCTTTGGTGTAGGAGCTGCATAAGAAATAGTTAAGGCTTTAAAAAATAAAATAAAA
AGAAAGGCTAGGTCTTCTCACCACCATTCCCCCACCATCCCTCACAAAATTACATTGAAA
GAGAAAATCACTGCGCCTTGAAAAAGGAAGTGGGGAGATAAGGCTGAAGAAACACCCTTG
TCTACGGCACTGATCAAACTACCACTGGTGCAGTAAGAAGCTTGTCCATCAGCTATGCTG
AGAATTGAAAAACCAGGGGTCCAGCTGAGCCAAGCTGGGAGGGGACCCACAGGTGGCACC
CAAGCCTGCAACTGTCGTGGATGAGATGAGAAAGTGGGAATGGGTAAACAATCTCTAAAG
GTCTACCAACAAAATTAGGATGAAGACCAGAATTAACAAATCATCTTCCCCGGCCACATC
CAGCCACAAACAAGTTTTGTTTGGCCTGTACAGTATATTTATTTTAATTTGAATTAGTTA
CTAATATTTATAAGTTGGATGCTAATTGTAGCTGTCCCCCCATCTCCGCCCCCCCCATCT
AAACTGGGAATGCCACTCGTAGTCCCCATCACTTAGCCCCTGATTTAGAGCCACAGGACT
GGAACAGAAGAAAGAAGACTCCATTCCACCCACTGTTTGGGCCAGCTCTGGGACAGCCAC
CTCCAACTGACACTCAGACTGGATTCCAGGAATCCCTTATGTGGGTCGTGCAGCACCTCA
GCACACATCTGTCCTTAAGAAGTCAAACGAACAGGGTGGTTTGTTCCTCAGGAAATCTCT
CCCATGCCTAGCAGAACTAGTTCAGTGTTGTTGAATCCCTTGTCAGTCATGGTCTCCCAG
GTGGGTCCACCTGAAGACAGCAGACAAGCACACACATCTAGGGGTGGACATGGAGAGGAC
CCCATGACAAATCTAGCCACCACTCCCTCCCTAGCTGTTTGAAACAGGGGAAGAGTGAGA
AGTTGCCTCCAAGGGAGGCAGGGGCTGGGGAACAGCTGCGGACCCTCTTACACAGTGGCA
TTTGCAAGGCAAGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved